Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... Zhang1, Kazumichi Furuyama1, Kiriko Kaneko1, Yuanying Ding1, Kazuhiro Ogawa2,*,Miki Yoshizawa1, Masaki Kawamura1, Kazuhisa Takeda1, Tadashi Yoshida3and Shigeki Shibahara11 Department ... 116 2–1 168.13 Nakayama M, Takahashi K, Kitamuro T, YasumotoK, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba-hara S (2000) Repression of heme oxygenase-1 byhypoxia in vascular endothelial ... line,and then subjected to northern blot analysis. Each lane contains15 lg of total RNA. The bottom panel shows the expression of b-actin mRNA as an internal control. (B) Western blot analysis. The indicated...
- 12
- 621
- 0
LONG TERM CHANGES IN VOTING POWER AND CONTROL STRUCTURE FOLLOWING THE UNIFICATION OF DUAL CLASS SHARES pdf
... For each unifying firm, we define its calendar unification year as year zero, and match the unifying firm’s data with the corresponding data of the control sample for the same calendar year. ... 1 and Table 2 present the evolution of the voting power of controlling shareholders in the main sample of unifying firms, and in the control sample of firms that chose to maintain their dual ... controlling shareholders are replaced) and of affiliation with a pyramidal business group in the main and control samples. The comparison between the main sample and the control group proceeds as...
- 46
- 354
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... as a major component of the amyloid plaques in AD brain[42,43], global AD research focused on this peptide as a causative agent in the disease. The 3 9–4 3 amino acidcleavage product of the Ab ... but the role for metal dyshomeostasis in all aspects is clear. In the AD affected brain, metaldyshomeostasis is evident in the form of a substantialincrease in the levels of extracellular metals ... stress, a loss of regulation of Abproduction, and an increase in tau hyperphosphoryla-tion. Furthermore, an increase in extracellular metalscan catalyse Ab oligomerization and aggregation, andthe...
- 9
- 634
- 0
INFLUENTIAL MARKETING: A NEW DIRECT MARKETING STRATEGY ADDRESSING THE EXISTENCE OF VOLUNTARY BUYERS doc
... the data available for training. In over-sampling, training samples of the minority class is over-sampled at random until the relative size of the minority and majority classes is more balanced. ... classification [HK01]. First, in the Learning stage, a model is learnt from a subset of the historical data, called the training set. By analyzing 7 each sample in the training set, the ... In under-sampling, instead of using all observations of the majority class to train the model, only a random subset of the majority class is used in addition to the minority class. Training...
- 67
- 600
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCCVK3.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCCVK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCCVK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCCVK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCAJH1-2.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCCJH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCCJH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCCJH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCCVL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTCVL6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCAJH1-2.link...
- 11
- 679
- 0
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc
... unsaturated side chain [1].Vitamin K2acts as a cofactor for a vitamin K-dependent carboxylase involved in the carboxylation of coagulation factors and is an essential substrate for blood coagulation ... double-stained with annexin V and propidium iodine using the ApoAlert Annexin V-fluorescein isothiocyanate apoptosiskit (Takara Bio Inc., Shiga, Japan).DNA fragmentation assayApoptosis was determined ... vitamin K2(MK-4). The inhibitory effect of vitamin K2and vitamin K1was evaluated with the MTTassay. The level of the absorbance in the MTT assay from untreated cells was taken as 100%. The...
- 7
- 455
- 0
Báo cáo y học: "Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less"
... and 7 in the tail of the pancreas. Notably one patient was demonstrated to have liver metastasis. The predominant presenting complaint was abdominal pain (8/18). The rest of the patients ... uncertainty of the strategy for its treatment. While further delineati n g the clinicopathological and radiological features, and summarizing the surgical therapy strategy of this ... patients in whom the mass was located in the portion of body or tail of the pancreas. For tumors of SPT located in the neck and body of the pancreas, resection of the mid-portion of the pancreas...
- 5
- 640
- 0
Tài liệu THE FIVE-YEAR ECONOMIC DEVELOPMENT STRATEGY FOR THE DISTRICT OF COLUMBIA (2012) doc
... timeline. This included each of the major phases of the project (planning, train-ing, quantitative analysis, interviews, data synthesis, report prepara-tion) and set a deadline for delivery of ... series of data inputs— nature of the initiative or project, initial estimate of the ongoing economic activity related to the initiative and requests for incen-tives associated with the initiative ... that became the raw material for the final report for its sector. The document included the sector analysis, a summary of the findings and ultimately the team’s recommendations and quantitative...
- 116
- 443
- 0
Ergonomic Principles and Checklists for the Selection of Office Furniture and Equipment doc
... reflected in the critical dimensions of seating. Because Australian anthropometric data are not available, the accompanying guidelines are based on data from various sources so as to reflect the wider ... population can be comfortably and suitably seated. With the increasing ethnic diversity of the Australian population there is a greater need to accommodate people at the extremes of the range, and ... centred approximately over the centre of rotation of the chair, that is, over the axis of the gas strut. The increase in seat depth caused by tilting the backrest column also allows for adjustments...
- 45
- 1,171
- 1
Từ khóa: a quantitative structure activity relationship for the gastroprotective effect of flavonoids evaluated in human colon adenocarcinoma ht 29 cellsdisplaying an image from a database in a web forms controlposition modifiers in a sentence so that they modify the right word and only that wordauthorised person means a person who is authorised for the purposes of the 2000 actsustainable scanning in a network an ambitious project for company territory synergies creationworking in a wired world customer service on the webq amp a websites to be considered in a social media marketing strategya rational strategy for the identification and testing of new agentsa territorial information system tis for the management of the seine estuary environmental and management applicationspropsal of strategy for the center in 2010 2014 perioda japanese book reading machine for the blindmagead a morphological analyzer and generator for the arabic dialectsa world bank economic update for the east asia and pacific regiona social networkbased trust model for the semantic web727 a more natural abel program for the example state machineNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ