Development and Aging of the Endocrine System
Aging of the Respiratory System: Impact on Pulmonary Function Tests and Adaptation to Exertion pdf
... and on the tension-time index [33] The tension-time index describes the relationship between force of contraction (Pdi/Pdimax) and duration of contraction (ratio of inspiratory time to total respiratory ... with aging [49] Reduction in supporting tissues around the airways further increases the tendency for the small airways (...
- 16
- 873
- 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... values analysis, item and subscales correlations and internal reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international ... adequate to generate reliable cross-cultural measures In conclusion, the Brazilian version of the AAQ instrument is a reliable, valid and consistent tool to assess attitudes to aging and can be ... raises the question of whether these similarities remain or not in other different cultures The demonstration of cultural invariance of the core attitudes to aging could lead to the possibility of...
- 10
- 871
- 0
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx
... values analysis, item and subscales correlations and internal reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international ... adequate to generate reliable cross-cultural measures In conclusion, the Brazilian version of the AAQ instrument is a reliable, valid and consistent tool to assess attitudes to aging and can be ... raises the question of whether these similarities remain or not in other different cultures The demonstration of cultural invariance of the core attitudes to aging could lead to the possibility of...
- 10
- 737
- 0
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx
... endocannabinoid system, we investigated the presence and regulation of endocannabinoids, cannabinoid receptors and FAAH in immature and mature dendritic cells obtained by stimulation with either the ... min), two fractions were obtained: a top leukocyte band containing mononuclear cells (monocytes and lymphocytes) and a lower band containing polymorphonuclear leukocytes (granulocytes) and the ... abundant band in human immature dendritic cells was the one at 83 kDa which may be related to a predominant glycosylation form of the CB1 receptor in these cells Additionally, in the rat brain lysate...
- 8
- 645
- 0
Rural and Micro Finance Regulation in Ghana: Implications for Development and Performance of the Industry ppt
... Microfinance Legislation in Uganda and Ethiopia 1a: Micro Deposit-taking Institutions in Uganda The push for a special regulatory niche for microfinance institutions in Uganda came in part from the ... 5.1: Assets of Depository Financial Institutions, 2001 (¢ million) 36 Review of Rural and Micro Finance Regulation in Ghana: Implications for Development and Performance of the Industry William ... Rural and Micro Finance Regulation in Ghana: Implications for Development and Performance of the Industry By William F Steel & David O Andah June 2003 Foreword his country study is one of...
- 62
- 414
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried out as described for ... human skin, normal epidermal and immortalized keratinocytes, dermal fibroblasts, squamous cell carcinoma and five human melanomas Thus, these data clarify in detail the cutaneous expression of the...
- 11
- 475
- 0
báo cáo hóa học: " Development and validation of the Treatment Related Impact Measure of Weight (TRIM-Weight)" pdf
... Conclusion The development and validation of the Treatment Related Impact Measure- Weight (TRIM -Weight) has been conducted according to well-defined scientific principles for the creation of a PRO measure ... debriefed version of the TRIM -Weight was incorporated into an online validation study to assess the measurement and psychometric properties of the measure As with the development phase, the validation ... generation in the development of two obesity-specific measures: the Obesity and Weight Loss Quality of Life (OWLQOL) Questionnaire and the Weight -Related Symptom Measure (WRSM) Clin Ther 2002, 24:690-700...
- 11
- 660
- 0
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... Here 54% of the insulin- treated agreed that insulin causes weight gain, compared to 23 % in the insulin naïve The highest mean score for insulin- naïve patients was on the item pertaining to the belief ... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrassing 14 Injecting insulin is painful ... < 0.001 Insulin naïve (n = 146) Mean (SD) Insulin signifies failure with pre -insulin therapy Insulin signifies diabetes has worsened Insulin will improve prognosis Insulin will make others perceive...
- 7
- 602
- 0
báo cáo hóa học: " Development and validation of the WEll-being and Satisfaction of CAREgivers of Children with Diabetes Questionnaire (WE-CARE)" potx
... been a dearth of studies to quantitatively assess either the well-being of parents of children with type diabetes or their satisfaction with their child's diabetes regimen The paucity of information ... as of their families [3] http://www.hqlo.com/content/6/1/3 new measure: the WEll-being and Satisfaction of CAREgivers of Children with Diabetes Questionnaire WECARE measures the psychosocial well-being ... material Additional file Appendix: The WEll-being and Satisfaction of CAREgivers of Children with Diabetes Questionnaire The parent questionnaire upon which the study was based Click here for...
- 9
- 478
- 0
báo cáo hóa học:" Development and validation of the Impact of Dry Eye on Everyday Life (IDEEL) questionnaire, a patient-reported outcomes (PRO) measure for the assessment of the burden of dry eye on patients" potx
... Development and validation of the Impact of Dry Eye on Everyday Life (IDEEL) questionnaire, a patient-reported outcomes (PRO) measure for the assessment of the burden of dry eye on patients ... Dry Eye SymptomBother, Dry Eye Impact on Daily Life, and Dry Eye Treatment Satisfaction, that allow a comprehensive evaluation of the burden of the dry eye condition on patients The assumption ... frequency Saturation was achieved for dry eye symptoms and these symptom sub-concepts, as well as for all of the overarching concepts of dry eye daily life impact and for the aforementioned sub-concepts...
- 32
- 686
- 0
báo cáo hóa học:" Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" pdf
... Here 54% of the insulin- treated agreed that insulin causes weight gain, compared to 23 % in the insulin naïve The highest mean score for insulin- naïve patients was on the item pertaining to the belief ... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrassing 14 Injecting insulin is painful ... < 0.001 Insulin naïve (n = 146) Mean (SD) Insulin signifies failure with pre -insulin therapy Insulin signifies diabetes has worsened Insulin will improve prognosis Insulin will make others perceive...
- 7
- 485
- 1
báo cáo hóa học:" Development and validation of the WEll-being and Satisfaction of CAREgivers of Children with Diabetes Questionnaire (WE-CARE)" pptx
... been a dearth of studies to quantitatively assess either the well-being of parents of children with type diabetes or their satisfaction with their child's diabetes regimen The paucity of information ... as of their families [3] http://www.hqlo.com/content/6/1/3 new measure: the WEll-being and Satisfaction of CAREgivers of Children with Diabetes Questionnaire WECARE measures the psychosocial well-being ... material Additional file Appendix: The WEll-being and Satisfaction of CAREgivers of Children with Diabetes Questionnaire The parent questionnaire upon which the study was based Click here for...
- 9
- 402
- 0
báo cáo hóa học:" The development and validation of the daily electronic Endometriosis Pain and Bleeding Diary" pdf
... measures of pain and the impact of endometriosis symptoms (i.e., the mBPI-SF pain intensity score and the EHP-30 pain subscale) and less correlated with the clinician-administered B&B Symptom Scale The ... 10.1186/1477-7525-8-64 Cite this article as: Deal et al., The development and validation of the daily electronic Endometriosis Pain and Bleeding Diary Health and Quality of Life Outcomes 2010, 8:64 ... (baseline), and at the end of the study The B&B Scale assesses the severity of the signs (pelvic tenderness, induration) and symptoms (dysmenorrhea, deep dyspareunia, and pelvic pain) of endometriosis...
- 9
- 289
- 0
Từ khóa: structures combining forms and functions of the endocrine systemdevelopment and maturation of the da systemdevelopment and aging of the oral mucosacalcineurin nfat signaling in development and function of the nervous systemdrugs of the endocrine system and metabolic agentsadvantages and disadvantages of the english system of measurementevaluation of the endocrine system involvesdisorders and diseases of the nervous system a listanatomy and physiology of the cardiovascular system pptfor and the development and maintenance of the code of good practicegroup cso participation and gender intergenerational issues in the development and implementation of the fip investment plan and dgm and comments from key governmental and nongovernmental stakeholdersincidence of invasive cancers of the endocrine systemnutrition and diseases of the nervous systempathophysiology common diseases and disorders of the muscular systempathophysiology common diseases and disorders of the nervous systemchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ