Exploring the contexts of relationship between in house prostitutes and surrounding community a case in mekabir sefer
Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx
... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war- 145 den" in German, and the use of present ... (auxiliary "haben') In this corpus, texts from the domains of law and economy contain more VAINF than others The potential meaning of common punctuation marks is quite clear: the longer the sentences...
- 8
- 689
- 1
EXPLORING THE ROLE OF PHARMACOKINETIC ALTERATIONS IN TYROSINE KINASE INHIBITORS (TKIS) ASSOCIATED TOXICITIES
... of tyrosine kinase inhibitors 110 5.3.2 Potential effect of enzyme inducer/inhibitor on pharmacokinetics of tyrosine kinase inhibitors 113 5.3.3 Effect of tyrosine kinase inhibitors ... Overcoming tyrosine kinase inhibitors- induced hepatotoxicity 160 6.5.1 Switching tyrosine kinase inhibitors 161 6.5.2 Alternative dosing 161 6.5.3 Reversibility of toxicities ... _ Summary The advent of molecular targeted therapy in the late 1990s marks a major breakthrough in the fight against cancer The critical role of tyrosine kinases in the control of cancer phenotypes,...
- 254
- 1,025
- 0
The effects of capital structure on firm performance and firm transparency a study of firms listed in ho chi minh stock exchange (hose)
... EFFECTS OF CAPITAL STRUCTURE ON FIRM PERFORMANCE AND FIRM TRANSPARENCY: A STUDY OF VIETNAMESE ON- GOING FIRMS LISTED IN HO CHI MINH STOCK EXCHANGE (HOSE) In Partial Fulfillment of the Requirements ... financial transparency index and firm performance? Research Objectives Generally, this thesis is an empirical study of effects of capital structure on firm value of on- going firms (financial firms ... on- going firms capital listed in HOSE and the relationship between capital structure and firm performance - 11 - - To examine the relationship between firm s capital structure and firm s financial...
- 72
- 742
- 1
báo cáo hóa học:" Salter-Harris II injury of the proximal tibial epiphysis with both vascular compromise and compartment syndrome: a case report" docx
... This is the first reported case with both vascular compromise and compartment syndrome secondary to a proximal tibial Salter-Harris injury An epidemiological study of epiphyseal growth plate injuries ... Burkhart SS and Peterson HA: Fractures of the proximal tibial epiphysis J Bone Joint Surg Am 1979, 61(7):996–1002 Shelton WR and Canale ST: Fractures of the tibia through the proximal tibial epiphyseal ... used conservative measures for displaced type I and II (MUA and cast in varying degrees of flexion) and open reduction and internal fixation of displaced type III, IV and V Some authors regret...
- 5
- 420
- 0
báo cáo khoa học: "The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention" pps
... article as: James: The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention Implementation Science ... language delay/disorder: A meta-analysis Journal of Speech Language and Hearing Research 2004, 47:924-943 18 Lewison G, Carding P: Evaluating UK research in speech and language therapy Int J Lang ... Education 2003, 28:133-137 13 Band S: Are health and education talking to each other? Perceptions of parents of children with speech and language needs European Journal of Special Needs Educaiton...
- 10
- 600
- 0
GRADUATION THESIS THE IMPACT OF VIETNAM – EU FREE TRADE AGREEMENT ON GEOGRAPHICAL INDICATIONS: A CASE STUDY OF HUNG YEN LONGAN
... increase the competitive advantages of Geographical indications – Hung Yen Longan of Vietnam in the Vietnam – EU free- trade agreement? ” In doing so, the author firstly analyzes the scale of VEFTA as ... Analyzing the trade scale between Vietnam and EU, the article Geographical indication in VEFTA and the background on geographical - indication of both parties Applying case study of Hung Yen longan Thus, ... Thus, this study focuses on answering the main question: - How to increase the competitive advantages of Geographical indications – Hung Yen Longan of Vietnam in the Vietnam – EU Free- Trade Agreement? ...
- 92
- 820
- 0
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx
... two annotation standards are naturally denoted as source standard and target standard, while the classifiers following the two annotation standards are respectively named as source classifier and ... for Segmentation and Tagging Table also lists the results of annotation adaptation experiments For word segmentation, the model after annotation adaptation (row in upper sub-table) achieves an ... the classification results of several successive characters We leave them as future research Table 2: An example of basic features and guide features of standard -adaptation for word segmentation...
- 9
- 404
- 0
Báo cáo y học: "Rare ileal localisation of angiolipoma presenting as chronic haemorrhage and severe anaemia: a case report" ppsx
... is novel Case presentation An 80-year-old man who underwent triple aortocoronary bypass surgery was affected by an aneurysm of the abdominal aorta, bilateral obstructive arteriopathy of the lower ... histological pre-operative diagnosis was not defined Figure it ment as appeared during with a hypervascularised baseIleal polypoid neoformationretrograde ileoscopy Ileal polypoid neoformation with a hypervascularised ... MS: Preoperative diagnosis of colonic angiolipoma: a case report World J Gastroenterol 2005, 11:5087-5089 Kato K, Matsuda M, Onodera K, Sakata H, Kobayashi T, Kasai S: Angiolipoma of the colon...
- 4
- 214
- 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... unable to say at this stage (26 – 39%) Statistical modelling The final stage of analysis focuses on the modelling of intentions and working as a nurse The relationships between intentions expressed ... Figure Path model of job satisfaction, future intentions and nursing at 18 months and years Path model of job satisfaction, future intentions and nursing at 18 months and years Odds Ratios are shown ... job satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relationships,...
- 12
- 530
- 0
Báo cáo y học: "Genomic analysis of the relationship between gene expression variation and DNA polymorphism in Drosophila simulans" pps
... 8.95) These cut-offs are arbitrary and chosen because they resulted in about half of the genes falling into 'average' gene expression and the remainder of the genes falling roughly equally into ... and that inclusion of these genes in the analysis may obscure an effect Thus, we repeated the analysis with the 500 genes with the strongest differences in expression among the lines The expression ... regulatory elements that might contain polymorphisms that contribute to expression variation A recent study examining polymorphism in the upstream 1-2 Kb of a small set of genes that vary and not vary...
- 14
- 390
- 0
Co-relationship between teacher-related factors and student's motivation in the context of Lomonoxop school, Hanoi = Quan hệ tương hỗ giữa yếu tố giáo viên và đ
... are in almost total control of the running of the classroom, including setting and enforcing rules, establishing procedures and organizing grouping activities These in turn greatly influence the ... context of Lomonoxop school, Ha Noi QUAN HỆ TƯƠNG HỖ GIỮA YẾU TỐ GIÁO VIÊN VÀ Đ NG LỰC HỌC TẬP CỦA HỌC SINH TRONG NGỮ CẢNH TRƯỜNG THPT DÂN LẬP LÔMÔNÔXỐP, HÀ NỘI M.A THESIS (Minor Programme Thesis) ... actively involved in the learning process Furthermore, they show more eagerness to the lessons of a certain teacher than of other teachers Therefore, there exists a problem of the role of a teacher and...
- 63
- 578
- 0
The mediating role of relationship quality in the relation between relationship benefits and word of mouth a study of the airlines ticket service
... mouth in business Specifically, the study indicates the relations between relationship benefits constructs and relationship quality and between relationship quality and word of mouth The study also ... 4.1 The revised research model 43 ABTRAST This study examines the mediating role of relationship quality in the relations between relationship benefits and word of mouth in Vietnamese airlines ... Specifically: The relationship between confidence benefits and relationship quality The relationship between special treatment benefits and relationship quality The relationship between social benefits and...
- 88
- 426
- 0
596 THE USE OF RELATIONSHIP MARKETING TECHNIQUES IN HIGHER EDUCATION A CASE STUDY
... Dalat 2.2.2 Chức năng, hiệu suất Marketing du lịch Dalat: Stephan Haeckel, giám đốc Viện Kinh doanh IBM, quan niệm “tương lai Marketing “một” chức doanh nghiệp, mà “cái” chức doanh nghiệp” Marketing ... Chiến lược Marketing 1.1.3.3 Chiến Lược Marketing du lịch 1.2 Vai trò chiến lược Marketing du lịch đ a phương 1.2.1 Vai trò chiến lược Marketing du lịch cho đ a phương ... lên nét chất Marketing phù hợp với giai đoạn phát triển Marketing, không tranh cãi hay phủ nhận vai trò, vị trí tác dụng Nhìn chung, Marketing coi thứ Oxy cung cấp sống cho thể kinh doanh Philip...
- 162
- 1,128
- 2
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
- 6
- 488
- 0
Từ khóa: nghiên cứu của parsva và lean 2011 the analysis of relationship between stock prices and exchange rates evidence from six middle eastern financial marketsexploring the use of financial analysis in the farming industryexploring the potential of biologically active compounds from plants and fungirelationship between supporting structures patterns and programming environments the number of stars ranging from zero to four is an indication of the likelihood that the given supporting structures pattern is useful in the programming environmentin vitro in vivo correlation of the causal relationship between cigarette smok ing and higher incidence of carcinomasthe role of communication competencies in international business relationship developmentcountries in which the number of scientific papers in science and engineering grew particularly sharply between 1988 and 2005how might the relationship between computer based trading and market abuse evolve in the next ten yearswhat role does infant and early childhood temperament play in the development of relationship with parentsthe relationship between computer self efficacy and playfulness of mobile phoneuse of monozygotic twins to investigate the relationship between 5httlpr genotype depression and stressful life events an application of item response theorythe relationship between intramolecular hydrogen bonds and certain physical properties of regioselectively substituted cellulose derivativesthe relationships between the phytoavailability and the extractability of heavy metals in contaminated soilsa et stephens n effects of relationship marketing on satisfaction retention and prices in the life insurance industry journal of marketing research novembre 1987 vol 24 404 411the grasshopper eats a clover in a field the clover is nourished by rain and sun the relationship between these organisms can be written as aBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ