Anticipated user experience in the early stages of product development
báo cáo hóa học: " Hypoxia silences the neural activities in the early phase of the phrenic neurogram of eupnea in the piglet" docx
... for the early and late phases of the phrenic neurogram during eupnea as well as the phrenic burst during gasping were estimated The mean ratios for the early, late phase during eupnea and gasping ... not influence phrenic neurons responsible for the neural activities in the late phase of the phrenic neurogram during inspiration In addition, it also significantly increases the duration of the ... disappeared during the early phase of the phrenic neurogram although the burst activity and the continuous activity remained, but both them appear at the late phase of the phrenic neurogram as maturation...
- 9
- 514
- 0
Báo cáo y học: "Serum keratan sulfate transiently increases in the early stage of osteoarthritis during strenuous running of rats: protective effect of intraarticular hyaluronan injection" docx
... weekly intraarticular hyaluronan injection helped maintain the smoothness of the surface of the articular cartilage (Figure 2) Histological analyses demonstrated that 30 km of strenuous running induced ... development of osteoarthritis in the knee joints of rats after strenuous running exercise [3] They stimulated the rats intracranially to motivate them to run on a running wheel In our present study, we ... for hyaluronan was demonstrated in areas that were simultaneously devoid of staining for keratan sulfate [6] These results may show the possibility that the effect of endogenous hyaluronan is insufficient...
- 8
- 370
- 0
Báo cáo y học: " High-risk HPV E5-induced cell fusion: a critical initiating event in the early stage of HPV-associated cervical cancer" pptx
... high-risk HPV E5-induced cell fusion may play a critical role in the early stage of HPV- associated cervical cancer However, it is widely accepted that increasingly deregulated expression of the E6-E7 ... early stage of HPV- associated cervical cancer This viewpoint will change our understanding of the mechanisms by which HPV induces cervical cancer According to this hypothesis, blocking HPV E5-induced ... critical event in the early stage of HPV- associated cervical cancer Presentation of the hypothesis The fact that aneuploid cells are frequently observed in precancerous lesions with elevated proportion...
- 3
- 309
- 0
Báo cáo y học: "Characterization of viroplasm formation during the early stages of rotavirus infection" ppsx
... are synthesized within viroplasms, which led to the hypothesis that the entering viral particles could serve as points of nucleation for the formation of viroplasms [8] In this work, the dynamics ... earlier stages of viroplasm formation, and in their work, following the expression of an NSP2 protein fused to EGFP in rotavirus SA-11 infected cells, they observed that the total number of viroplasms ... Characterization of viroplasm formation during the early stages of rotavirus infection Virology Journal 2010 7:350 Submit your next manuscript to BioMed Central and take full advantage of: • Convenient...
- 11
- 358
- 0
báo cáo khoa học: " Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana" docx
... (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAA TGGCGGCGGATGCTCTGAG3' and 5'GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCAGCAACTTCTTCTTGAT CCTTG3') The expression clone was inserted into the donor vector pDONR201, and subsequently transformed ... through PCR amplification with the primer LBa-1 (located on the TDNA insert: 5'TGGTTCACGTAGTGGGCCATCG3') and primers flanking the predicted inserts (5'AAAAACAAAAGCAGACATCGAC3' for sco1-2, 5'GACCAAACAAAATCACAATAAG3' ... 5'GACCAAACAAAATCACAATAAG3' for sco1-3, and 5'ATGAAACACGAGCTATATTGAG3' for sco1-4) Wild-type and all sco1 seed were sown on 1% agar growth medium containing 0.5-strength MS salts (Gibco/Life Technologies,...
- 10
- 464
- 0
Báo cáo khoa học: "Neuromuscular deterioration in the early stage of sepsis in rats" ppt
... recordings in the early stage of sepsis, we obtained EMG recordings of the rats in the first 24 hours after CLP We did not aim to observe clinical signs of sepsis; therefore, the animals were euthanized ... obtained during early periods of clinical sepsis indicated that the decrease in amplitude of CMAP was accompanied by an increase in duration without any change in latency This finding directed ... number of the muscle fibers that led to the decrease of the amplitude and prolongation of CMAP in the sepsis group Conclusion Our results indicate that electrophysiological findings appeared in the...
- 7
- 240
- 0
Báo cáo y học: "Challenges of controlling sleeping sickness in areas of violent conflict: experience in the Democratic Republic of Congo" ppt
... complexity (from 56 to 14 infusions) of the previously preferred treatment of eflornithine monotherapy [15-17] However, NECT administration remains labour-intensive, requiring days of infusions of ... mainly Page of because of the remoteness of the areas [1] These areas border others with a history of HAT in CAR and South Sudan In mid-2007, MSF launched projects to detect and treat HAT in the ... state is further eroded by insecurity • Insecurity often hinders active case-finding activities since mobile teams are often restricted in their travel • Populations often move, hampering treatment...
- 8
- 269
- 0
Báo cáo y học: "Insufficient β-lactam concentrations in the early phase of severe sepsis and septic shock" potx
... variables This finding may be related to the fact that the PK analyses were performed during the early phase of sepsis Also, as a first dose of antibiotic is largely influenced by Vd, the increased ... recommendations on dosing in severe infections, especially in the early phase of severe sepsis and septic shock Key messages • Recommended doses of piperacillin-tazobactam, cefepime and ceftazidime ... to the body weight PK end-points The threshold of MIC required for maximal β-lactam activity is still controversial In this study, the adequacy of β-lactam therapy was assessed by calculating the...
- 9
- 327
- 0
Báo cáo y học: " Transcriptional control in the prereplicative phase of T4 development" pot
... mutations in T4 that increase the synthesis of the early gene product rIIA [86] In fact, expression of several early genes increase in the T4 motA- infection, presumably because of a delay in the shift ... [reviewed in [36,37]] The formation of the RNA hairpin by an intrinsic terminator sequence may facilitate termination by destabilizing the RNA/DNA hybrid Rhodependent termination is mediated through the ... G:C, -30 C:G at the center of the MotA box In wt T4 DNA, each cytosine in this sequence is modified by the presence of a hydroxymethylated, glucosylated moiety at cytosine position This modification...
- 16
- 294
- 0
Combining DEMO models with RAD's techniques in the analysis phase of software development process
... difficulties in defining software requirements and business process modeling DEMO can help capture the business processes of the organization while RAD technique links these business processes to the software ... steps of the related transactions Capturing the business processes of the organization, it can be used as the starting point to design the supporting system for the organization Combining with ... improved Therefore, we have developed a new framework for the analysis phase of the software development process where we combined the IAM and the PM with the traditional RAD technique In every...
- 4
- 333
- 0
Báo cáo y học: " Open Access The association between bullying and early stages of suicidal ideation in late adolescents in Greece" pdf
... to test the association between bullying behavior and early stages of suicidal ideation in a sample of Greek adolescents and to examine whether this is independent of the presence of psychiatric ... disorders on the one hand and suicidal ideation and psychiatric disorders on the other [50] In our study we confirmed the confounding effect of psychiatric morbidity especially for the bullying others” ... Comparison with previous studies and interpretation of the findings We are not aware of other studies of the association between bullying and suicidal ideation in Greece and therefore we will base our...
- 9
- 483
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... endothelium and resulted in the formation of atherosclerosis (9) Javid et al also found that in the early stage of atherosclerosis, the number of Cx43 gap junction plaques increased and the diameter ... antagonists are mediated through decreasing VSMC seamless connections The present study aimed to detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis ... study demonstrates an association of the formation of atherosclerosis and the ex- pression and function of gap junction White blood cells (WBC) can be induced by chemokines through gap junction...
- 8
- 467
- 0
Từ khóa: treating bipolar disorder in the early stages of illnessstill in the early stages of developmentwomen s involvement in the initial stages of the criminal justice systemin the early stage of hybrid rice technological development wa was the only source of male sterile cytoplasm this presented potential vulnerabilities from disease or insect epidemics such as the southgait disturbances typical to the early stages of the diseasetreatment of gait disturbances in the advanced stages of parkinsonismthe role of procalcitonin in the early diagnosis of septic and non septic complications in the ichoice of problems in the early days of biological nmr spectroscopyan in depth interview for conceptualizing user experience in the korean mobile phone industrythe inflammatory tissue microenvironment and the early stages of malignancyα counteracts the early stages of skeletal metastasis by prostate cancer cellsplan design evaluate release how to use personas during the stages of product developmenta tool at the heart of tensions and opportunities in the organizational project of sustainable developmentimplantation and early stages of fetal developmentearly stages of emotional developmentNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui rochuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ