Anatomy and Function of a Gene: Dissection Through Mutation (cont)
Anatomy and Function of a Gene: Dissection Through Mutation (cont)
... mutagenic chemicals Cells have evolved a number of enzyme systems that repair DNA and thus minimize mutations Mutations are the raw material of evolution Although some mutations may confer a selective ... of an autosomal gene VNU-University of Science - DNThai Alkaptonuria: An inborn error of metabolism The biochemical pathway in humans that degrades phenylalanine and tyrosine via homogentisic acid ... acid (HA) In alkaptonuria patients, the enzyme HA hydroxylase is not functional so it does not catalyze the conversion of HA to maleylacetoacetic acid As a result, HA, which oxidizes to a black...
- 24
- 199
- 0
Anatomy and Function of a Gene: Dissection Through Mutation
... – bacteria – Used at replication forks that stalled because of unrepaired DNA damage – "Sloppy" DNA polymerase used instead of normal polymerase – Adds random nucleotides opposite damaged bases ... DNThai General observations of mutation rates • Mutations affecting phenotype occur very rarely • Different genes mutate at different rates • Rate of forward mutation is almost always higher than ... 7.1 Mutations: Primary tools of genetic analysis • Mutations are heritable changes in DNA base sequences • Forward mutation – changes wild-type allele to a different allele – e.g A+ a or b+...
- 56
- 220
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria 2 2 2 2 ... Chromohalobacter salexigens DSM3034 Acinetobacter sp (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria...
- 13
- 390
- 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot
... this gene was designated naoA (nitroalkane-oxidizing enzyme gene) Expression of naoA in E coli To study the function of the naoA gene, it is necessary to obtain an adequate amount of NaoA protein ... recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers (phosphorylase b, 97 kDa; ... sequence of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces; partial purification of the related enzyme from Streptomyces has been reported [16] The deduced aminoacid sequence of NaoA from...
- 6
- 255
- 0
Design and Implementation of a Three-Phase Induction Motor Control Scheme
... processes and variables are modelled mathematically Furthermore, the MATLAB program can convert a MATLAB design into a C-code design in a relatively straightforward manner Hence, this stage of the ... two-phase currents to generate a means of instantaneously controlling the torque and flux Field-orientated controllers require control of both magnitude and phase of the AC quantities and are, ... the induction motor s many advantages are clearly explained Wildi also presents the two types of induction motors: “the squirrel cage induction motor and the “wound motor An explanation of the...
- 93
- 693
- 1
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx
... work was supported in part by an Ontario Graduate Scholarship, Natural Sciences and Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun ... the manuscript TC conceived the study, advised on the design and coordination of the experiments, and edited the manuscript All authors read and approved the final version of the manuscript Acknowledgements ... factor was selectable in the 1.2-2.5 range, and was adjusted for each participant such that false activations due to blinks and movement were avoided and participants were able to activate the switch...
- 10
- 501
- 0
Design and development of a self balancing bicycle using control moment gyro
... moment gyro (CMG) as an actuator The control moment gyro (CMG) is typically used in a spacecraft to orient the vessel [5] Appling a CMG as an actuator to balance a bicycle is a creative and novel approach; ... provides a comparison of the various methods to balance a bicycle, evaluated their advantages and disadvantages The most significant contribution of this research is the use of a CMG as an actuator ... torque applied to the handlebar to balance the bicycle Advantages of such a system include low mass and low energy consumption Disadvantages of such as system is its lack of robustness against large...
- 59
- 1,288
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg ... TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 Fig Sequence of recombinant plasmid DNA containing TI gene fragment Expression...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... domain of each subunit contributes to the formation of the hydrophilic pore ACh binding protein has structural and functional homology to the extracellular ligand binding domain of the nAChR, and ... development of selective drugs is the identification and pharmacological characterization of the various receptor subtypes, and the determination of their precise subunit composition and physiological function( s) ... targets the a/d interface of the mammalian muscle nAChR and is the only ligand selective for the Torpedo a/d interface [33] (Fig 2A) However, information on the activity of EI at neuronal subtypes...
- 15
- 757
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... C An et al Manduca sexta Spatzle ¨ Introduction A prominent feature of the innate immune systems of insects is the activation of serine proteinase cascade pathways in hemolymph, which function ... gene In the clade including Spatzle- 1, the branch lengths are noticeably longer and ¨ the bootstrap values are lower than in the other clades containing Spatzle- 2 to Spatzle- 6, indicating a lower ... cleavage of proSpatzle- 1A after ¨ incubation with the M sexta clip-domain serine proteinases HP6 or proPO-activating proteinase-1 (data A not shown) In the absence of b-mercaptoethanol, Spatzle- C108...
- 15
- 540
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax ... proteins A- 6-D45918: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl -D-amino acid amidohydrolase; A- 6-D45919: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl-D-Asparate amidohydrolase; A- 6-D50061:...
- 11
- 656
- 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the reaction Analysis was ... B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms are 38.14 A ively It is therefore reasonable to propose that conformational ... indicates the absence of any structural perturbation caused by the mutation Aminoacid analysis of the SDTG-modified Phe51Ala mutant and determination of its total amino and carboxy content suggests that...
- 9
- 556
- 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction ... TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression and purification of the recombinant ... this paper, we report the gene cloning and characterization of a thermostable Lon protease from Brevibacillus thermoruber WR-249 We show that the recombinant Br thermoruber Lon protease (Bt -Lon) ...
- 11
- 505
- 0
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... retrieved from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and ... Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana Gene 288, 129–138 Tanaka S, Ikeda K, Ono M & Miyasaka H (2002) Isolation of several anti-stress genes...
- 14
- 347
- 0
Từ khóa: Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP