0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Master of Environmental Studies in Environment and Resource Studies

A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx

A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx

... negative charges fall toward the GaAs side but are attracted by the positive charges that remain on the AlGaAs side This results in the bands bending and confining the charge at the “perfect” AlGaAs-GaAs ... twodimensional atomic layers of atoms These are among the thinnest objects imaginable The strongest bond in nature, the C-C bond covalently locks these atoms in place giving them remarkable mechanical ... total capacitance of the dot This is known as the charging energy of the dot and having to pay this energy cost is known as Coulomb blockade A small dot has a small capacitance and a large charging...
  • 140
  • 510
  • 0
A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Master of Environmental Studies in Environment and Resource Studies

A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Master of Environmental Studies in Environment and Resource Studies

... Some
cracks in the theory
– the example of exergy and waste
impact
 A second argument for re-examining the underlying theory connecting exergy and resource value is that there are already cracks appearing in application of exergy ... destruction of a resource is a measure of the amount by which the value of the resource is consumed, and the exergy of a resource is a measure of the value of a resource (Brodianski ; Wall 1977; Gong and ... understand that my thesis may be made electronically available to the public ii Abstract
 The objective of this thesis is to establish the utility and limitations of using exergy (a thermodynamic...
  • 128
  • 314
  • 0
A Master’s Research Project Presented to The Faculty of the College of Education Ohio University pdf

A Master’s Research Project Presented to The Faculty of the College of Education Ohio University pdf

... and analysis By placing students in a market situation and asking them to interpret their behavior and observations and to analyze the market results, they are able to move from abstraction to ... email addresses I then contacted these social studies teachers and explained the purpose of my research project and asked them how many years they had been teaching, how many years they had taught ... responses The participant’s responses were detailed and hence easy to analyze I analyzed each individual question separately in order to obtain an accurate analysis 21 While analyzing each participant’s...
  • 42
  • 515
  • 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... advantage of the top-down approach is that a final separation stage can be done in the FT MS instrument For example, after rough separation of the proteins from Arabidopsis thaliana, the stromal ... dissociation spectral data, YjbV fragment peaks The ‘) 20 ’ after the molecular mass value signifies that the main component ion of the most abundant isotopic peak contains 20 13C atoms and has this ... reason for a Da decrease is the formation of an S–S bond; although this was totally unexpected and unprecedented, the top-down approach efficiently gave a specific characterization of the inhibitor...
  • 13
  • 572
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

... algorithm to the context vectors, we should obtain the two expected clusters Each of the two clusters corresponds to one of the senses of palm, and the words closest to the geometric centers of the ... strength to the ambiguous word, in each matrix we removed all words that are not among the top 30 first order associations to the ambiguous word These top 30 associations were computed fully automatically ... been found According to our judgment, all words in the upper branch of the hierarchical tree are related to the hand sense of palm, and all other words are related to its tree sense However, it...
  • 4
  • 536
  • 0
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

... /21.67    total amount due Fundamentals of NGO Management Sick Annual Taken Annual leave days remaining 47 Fundamentals of NGO Management Annex 20: Honoraria agreement Name of organisation: An ... previous financial year • records of statutory payments made, particularly on staff salaries • details of all assets The auditor may also ask to see: • a list of accruals – income the organisation has ... depicts the overall status 15 Fundamentals of NGO Management of the organisation’s finances at a fixed point in time – usually at the end of its financial year All assets are added and all liabilities...
  • 76
  • 576
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA- PBAD-R OMCB- PBAD-F OMCB- PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of ... into the dependence of dissimilatory metal reduction by MR-1 on OmcA and OmcB Results Growth analyses of anaerobically metal- respiring omcA , omcB and omcA omcB MR-1R mutants relative to their...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

... word from the centroid of its closest cluster, and to assign the differential vector to the most appropriate other cluster This process can be repeated until the length of the differential vector ... (2004) Toward unsupervised wholecorpus tagging Proceedings of COLING, Geneva, 357-363 Rapp, Reinhard (2004) A practical solution to the problem of automatic word sense induction Proceedings of ACL ... results of the vector comparisons Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability to...
  • 4
  • 433
  • 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried ... [33], the peptides containing a b-amino acid substitution in position have increased stability compared to the corresponding a- amino -acid- containing peptides Therefore it is possible to increase peptide ... acid incorporation When Phe7 or Phe8 are replaced by b2-HPhe, the corresponding analogues are weak competitors of specific NK-1 binding sites These amino acids are in the helical domain of SP which...
  • 11
  • 860
  • 0
A further contribution to the study of the mortuary customs of the North American Indians docx

A further contribution to the study of the mortuary customs of the North American Indians docx

... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... Indians he learned that tradition among the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, known as Karkhayahouchak Last year the captain was in the ... ceases, at the end of the year, they have high mass said for the benefit of the soul of the departed; after this they again appear upon the arena of their wild sports and continue to be gay and happy...
  • 108
  • 604
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... morphological processing to encode these notions We view the parsing system as a partial but general theory of morphological processing, and the work we have done on Warlpiri as a particular instantiation...
  • 8
  • 522
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt

... found in the list of pseudo-roots In that case, the transliteration subroutine dictates the form of the correspondent to be stored in the normal position of the target T for the final printout A ... signal is stored in GS and the tag t is placed in the normal position of the target T for final printout ILLUSTRATION As an example of the performance of this section of the program, we offer the text ... such is the case, an appropriate signal is added to the profile skeleton, in which the nature of the non-word occurrences has previously been stored The profile skeleton will be subjected to a crude...
  • 18
  • 701
  • 0

Xem thêm

Từ khóa: who shall survive a new approach to the problem of human interrelationsa practical solution to the pervasive problems of p valuesa practical solution to the problem of asphaltene depositsa practical solution to the problem of ultimate ruin probabilitya beginners guide to the study of religion pdfa beginners guide to the study of religion ebooka beginners guide to the study of religion herling20  placing a pull quote to the side of a columnisotropic phase of sclc polymers a new approach to the molten state3  appending a new element to the end of a pagesheep breeding in colonial canterbury new zealand a practical response to the challenges of disease and economic change 1850 1914graphic design arguably is itself a grand portal to the process of educationa general solution to the challenge of activexa rollicking journey to the heart of college football7 1 result of primenumbers html used as a front end to the primenumbers servletNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ