Sử dụng kỹ thuật DAS ELISA và RT PCR để phát hiện virus gây bệnh đốm võng trên cây đu đủ (papaya ringspot virus) tại hai tỉnh Đồng Nai và Đồng Tháp


  • 9
  • 164
  • 0


... ABI3100_I-M30_006_2005-08-24 693 CATGGGAGAGCACTCAGTTGCGCGGCAGAGGAAGAGAGCGCATGCACAAG 730 890 CATGGGAGAGCACTCAGTTGCGCGGCAGAGGAAGAGAG 93 5 ****** *** * ***** ************ * *92 6 ABI3100_I-P7_004_2005-08-24 ... TTGTCTGGTGTTTGGGTAATGATGGATGGGGAAATACAAGTAGATTATCC 297 601 TTGTCTGGTGTTTGGGTAATGATGGATGGGGAAATACAAGTAGATTATCC 6 49 *********************** * * ********************** ABI3100_DQ17-P7_015_2005-08ABI3100_DQ17-M30_002_2005-08 298 CATCA-AGCCTTTAATTGAACATGCAACTCCCTCGTTTAGGCAAATCATG ... ABI3100_DQ17-P7_015_2005-08ABI3100_DQ17-M30_002_2005-08 397 GAGAGGAGTGAAAGTTCCCCTGGTCCCCAAAACGGAGGGGTAGGAAAAGG 446 ABI3100_DQ17-P7_015_2005-08ABI3100_DQ17-M30_002_2005-08 447 A - CCACT 396 391 -P7 74 Phụ lục...
  • 10
  • 155
  • 0


... GHI CHÖ MẪU SỬ DỤNG TRONG THÍ NGHIỆM ELISA Tỉnh Đồng Tháp Địa bàn Tỉnh Đồng Nai Huyện Định Quán MH Huyện Tân Phú ĐQ Huyện Cao Lãnh TP BT Tuổi (*) 6 -8 6 -8 6 -8 6 -8 4-5 4-5 6 -8 >12 6 -8 9-11 >12 >12 ... tƣợng: Mẫu ly trích từ đu đủ Thời gian thực hiện: 25-5-2005 Các bƣớc thực hiện: Bƣớc 1: Coating antibodies Bƣớc 2: Coating sample Bƣớc 3: Coating enzyme Bƣớc 4: Substrate Thể tích phân phối: Coating ... tác đu đủ tỉnh Đồng Nai Phụ lục Vƣờn canh tác đu đủ tỉnh Đồng Tháp 62 Phụ lục Bộ kit ly trích AurumTM Total RNA Mini Kit Phụ lục Hình chụp kết thí nghiệm với kit PLANTEST® ELISA 63 Phụ lục 5: BẢNG...
  • 10
  • 150
  • 0


... nhiễm bệnh địa điểm: Xã Mỹ Hiệp: 92,68 % Xã Bình Thạnh: 77 ,42 % Xã Phú Tân: 47, 37 % Xã Phú Lộc: 47, 37 % Xã Phú An: 16 % - Tỉ lệ nhiễm bệnh theo giống cây: Giống Da bông: 86,54 % Giống Mã Lai: 80 ... 80 % Giống Địa phƣơng: 34,92 % - Tỉ lệ nhiễm bệnh theo tuổi cây: – tháng: 70 % – tháng: 85 ,71 % – 11 tháng: 12,5 % Trên năm: 36,11 % Kết với thí nghiệm RT-PCR - Cặp mồi 1: cặp mồi không đặc hiệu, ... trình RT-PCR thiết lập với cặp mồi P7-M30, P14-M31 hoàn toàn đáng tin cậy 56 PHẦN V KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Dựa kết thu đƣợc, đến kết luận nhƣ sau: Kết từ thí nghiệm với kit DAS ELISA:...
  • 10
  • 121
  • 0


... % - Xã Phú An: 16 % Nhận xét thấy tỉ lệ nhiễm bệnh vùng Đồng Tháp cao hẳn Đồng Nai điều kiện dinh dƣỡng khí hậu Đồng Tháp tốt thuận lợi Đồng Nai Nguyên nhân Đồng Tháp dù bị nhiễm virus song đƣợc ... chủ yếu thu mẫu từ tỉnh Đồng Nai tiêu ta so sánh tình hình nhiễm bệnh hai giống Da Mã Lai thu thập tỉnh Đồng Tháp Theo đồ thị trên, nhận thấy giống Da có tỉ lệ nhiễm bệnh đốm vòng cao giống Mã ... thấy tỉ lệ nhiễm bệnh theo tuổi nhƣ sau: - Từ - tháng: 70 % - Từ - tháng: 85,71 % - Từ - 11 tháng: 12,5 % - Trên năm: 36, 11 % 44 Nhƣ biết, virus PRSV thƣờng phát triển lây lan mạnh vào thời kì bắt...
  • 10
  • 144
  • 0


... agarose - Sử dụng gel nồng độ 1 ,5 % (đối với ladder có kích thƣớc 1000 bp) - Sử dụng gel nồng độ % (đối với ladder kích thƣớc 150 0 bp) Bơm mẫu vào giếng với tỉ lệ mẫu/ loading dye 4:2 Trƣớc bơm vào ... ứng PCR chuẩn đƣợc thực 25 μl bao gồm: (Roberto C.A Lima, 2002) Hóa chất Nồng độ đầu Nồng độ cuối Thể tích sử dụng iTaq buffer 10 X 1X 2 ,50 μl MgCl2 50 mM 3 ,5 mM 1, 75 μl dNTP mix 10 mM 0,4 mM ... Thể tích sử dụng iTaq buffer 10 X 1X 2 ,50 μl MgCl2 50 mM 3 ,5 mM 1, 75 μl dNTP mix 10 mM 0,4 mM 1,00 μl iTaq DNA polymerase u/μl 2u 0,40 μl 14, 85 μl Nuclease-free water DMSO 100 % 2% 0 ,50 μl Primer...
  • 10
  • 183
  • 0


... lấy mẫu: - Xã Mỹ Hiệp, xã Bình Thạnh, huyện Cao Lãnh, tỉnh Đồng Tháp - Xã Phú Lộc, xã Phú An, huyện Tân Phú, tỉnh Đồng Nai - Xã Phú Tân, huyện Định Quán, tỉnh Đồng Nai Nơi thực thí nghiệm: Trung ... Stt Tỉnh Huyện Đồng Tháp Cao Lãnh Xã Mỹ Hiệp 45 Bình Thạnh 35 Phú Tân 20 Phú Lộc 20 Phú An 25 Định Quán Đồng Nai Số lƣợng mẫu Tân Phú Tổng số mẫu 145 3.3 Phƣơng pháp giám định bệnh đốm vòng đu đủ ... loại bệnh dùng phƣơng pháp hóa học để chẩn đoán dựa vào xuất màu sắc nhƣ dùng dung dịch CuSO4 3% để chẩn đoán bệnh virus Cucumis virus Phƣơng pháp huỳnh quang để chẩn đoán mô quả, hạt bị bệnh...
  • 10
  • 181
  • 0


... vòng đu đủ (Papaya ringspot virus) , khảm lùn ngô (Maize dwarf mosaic virus) + Nhóm truyền bệnh nửa bền vững: Gồm virus có đặc tính truyền trung gian hai nhóm Điển hình virus Tungro hại lúa, virus ... từ vài tiếng đến tuần lễ có khả lây bệnh cho Ví dụ gây bệnh xoăn cà chua (Tomato leafcurl virus) , virus gây bệnh khoai tây (Potato leafrool virus) + Nhóm truyền bệnh theo kiểu không bền vững: ... bệnh 16 Phân loại: H : Potyviridae Giống: Potyvirus Loài: Papaya ringspot virus Tên viết tắt: PRSV Dòng: type P Nguồn gốc: PRSV-p đƣợc phân lập nghiên cứu lần vào năm 1949 đu đủ Hawaii (Jensen,...
  • 10
  • 205
  • 2


... phạm vi khoá luận tốt nghiệp, xin thực với nội dung Sử dụng kỹ thuật DAS-ELISA RT-PCR để phát virus gây bệnh đốm vòng đu đủ (Papaya ringspot virus) hai tỉnh Đồng Nai Đồng Tháp 1 .2 Mục đích - ... thập mẫu đu đủ số vùng chuyên trồng đu đủ Đồng Nai Đồng Tháp - Chẩn đoán nhanh đánh giá tình hình nhiễm bệnh kit ELISA - Xây dựng quy trình RT-PCR để nhận biết virus gây bệnh đốm vòng đu đủ - Phân ... qua sử dụng thuật RT-PCR PHẦN II TỔNG QUAN TÀI LIỆU 2. 1 Sơ lƣợc đu đủ (Carica papaya L ) 2. 1.1 Phân loại học - Tên khoa học: Carica papaya L - H : Caricaceae (hay Papayaceae- họ đu đủ) Đu đủ...
  • 10
  • 168
  • 0


... tháng năm 2005 “SỬ DỤNG KỸ THUẬT DAS-ELISA RT-PCR ĐỂ PHÁT HIỆN VIRUS GÂY BỆNH ĐỐM VÒNG TRÊN CÂY ĐU ĐỦ (Papaya ringspot virus) TẠI HAI TỈNH ĐỒNG NAI VÀ ĐỒNG THÁP” Giáo viên hƣớng dẫn: PGS.TS Bùi ... DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP HCM BỘ MÔN CÔNG NGHỆ SINH HỌC ***000*** KHÓA LUẬN TỐT NGHIỆP SỬ DỤNG KỸ THUẬT DAS-ELISA RT-PCR ĐỂ PHÁT HIỆN VIRUS GÂY BỆNH ĐỐM VÕNG TRÊN CÂY ĐU ĐỦ (Papaya ... 10 2 .1. 7.2 Các bệnh phổ biến đu đủ 10 2.2 Sơ lƣợc Papaya ringspot virus tác hại đu đủ 11 vi 2.2 .1 Khái niệm chung bệnh virus hại thực vật 11 2.2.2 Virus gây bệnh đốm vòng-...
  • 10
  • 188
  • 0

Tách dòng, xác định so sánh trình tự gen mã hoá Nuclear Inclusion Body protein (NIb) của một số dòng virus gây bệnh đốm vòng trên cây đu đủ (Papaya Ringspot virus-PRSV) ở Việt Nam

Tách dòng, xác định và so sánh trình tự gen mã hoá Nuclear Inclusion Body protein (NIb) của một số dòng virus gây bệnh đốm vòng trên cây đu đủ (Papaya Ringspot virus-PRSV) ở Việt Nam
... Lăng, Lê Trần Bình (2004), Đánh giá tính đa dạng dòng virus gây bệnh đốm vòng đu đủ Việt Nam thông qua tách dòng, xác định so sánh trình tự gen hoá protein vỏ (CP), Tạp chí Công nghệ sinh học, ... dòng virus gây bệnh đốm vòng đu đủ Việt Nam thông qua tách dòng, xác định so sánh trình tự gen hoá protein vỏ (CP) cho thấy 16 dòng PRSV phân lập từ khu vực khác Việt Nam có mức độ giống từ ... sánh trình tự gen thu đợc Các bớc tiến hành nh sau: + So sánh trình tự gen đợc đọc từ hai đầu xuôi đầu ngợc để xác định trình tự đầy đủ gen + Xác định đợc vị trí, số lợng enzym hạn chế trình tự...
  • 39
  • 769
  • 5

Sử dụngthuật Das-Elisa RT-PCR để phát hiện vi rút gây bệnh đốm vòng

Sử dụng kĩ thuật Das-Elisa và RT-PCR để phát hiện vi rút gây bệnh đốm vòng
... Minh, tháng năm 2005 “SỬ DỤNG KỸ THUẬT DAS-ELISA RT-PCR ĐỂ PHÁT HIỆN VIRUS GÂY BỆNH ĐỐM VÒNG TRÊN CÂY ĐU ĐỦ (Papaya ringspot virus) TẠI HAI TỈNH ĐỒNG NAI VÀ ĐỒNG THÁP” Giáo vi n hƣớng dẫn: PGS.TS ... thực hiện: - Tiến hành lấy mẫu bệnh đốm vòng đu đủ hai tỉnh điều tra - Sử dụng thuật DAS ELISA để chẩn đoán đánh giá mức độ nhiễm bệnh đốm vòng hai tỉnh - Thiết lập quy trình RT-PCR để phát ... ii BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP HCM BỘ MÔN CÔNG NGHỆ SINH HỌC ***000*** KHÓA LUẬN TỐT NGHIỆP SỬ DỤNG KỸ THUẬT DAS-ELISA RT-PCR ĐỂ PHÁT HIỆN VIRUS GÂY BỆNH ĐỐM VÕNG TRÊN...
  • 99
  • 1,094
  • 4

Khóa luận tốt nghiệp ứng dụng kỹ thuật rt - pcr để phát hiện virus gây hội chứng rối loạn sinh sản hô hấp ở lợn

 Khóa luận tốt nghiệp ứng dụng kỹ thuật rt - pcr để phát hiện virus gây hội chứng rối loạn sinh sản và hô hấp ở lợn
... phỏp RT- PCR trờn RNA virus 25 3.5.6 in di sn phm RT- PCR 27 PHN IV: KT QU V THO LUN 28 4.1 Kt qu RT- PCR trờn mu chun ca PRRSV 28 4.1.1 RT- PCR vi Taq beat hot start (Promega) ... 3.2 Thnh phn phn ng RT- PCR 25 Bng 3.3 Chu k nhit cho phn ng RT- PCR 26 Hỡnh 4.1 Sn phm RT- PCR trờn mu RNA chun dựng vi Taq Beat Hot Start 28 Hỡnh 4.2 Sn phm RT- PCR trờn mu RNA chun ... Phn IV KT QU V THO LUN 4.1 Kt qu RT - PCR trờn mu RNA chun ca PRRSV 4.1.1 RT- PCR vi Taq beat u tiờn, thit lp quy trỡnh RT- PCR, chỳng tụi ó tin hnh phng phỏp RT- PCR mt bc trờn mu chun (quy trỡnh...
  • 54
  • 754
  • 1

Ứng dụng kỹ thuật RT - PCR để phát hiện virus gây hội chứng rối loạn sinh sản hô hấp ở lợn

Ứng dụng kỹ thuật RT - PCR để phát hiện virus gây hội chứng rối loạn sinh sản và hô hấp ở lợn
... phỏp RT- PCR trờn RNA virus 25 3.5.6 in di sn phm RT- PCR 27 PHN IV: KT QU V THO LUN 28 4.1 Kt qu RT- PCR trờn mu chun ca PRRSV 28 4.1.1 RT- PCR vi Taq beat hot start (Promega) ... 3.2 Thnh phn phn ng RT- PCR 25 Bng 3.3 Chu k nhit cho phn ng RT- PCR 26 Hỡnh 4.1 Sn phm RT- PCR trờn mu RNA chun dựng vi Taq Beat Hot Start 28 Hỡnh 4.2 Sn phm RT- PCR trờn mu RNA chun ... Phn IV KT QU V THO LUN 4.1 Kt qu RT - PCR trờn mu RNA chun ca PRRSV 4.1.1 RT- PCR vi Taq beat u tiờn, thit lp quy trỡnh RT- PCR, chỳng tụi ó tin hnh phng phỏp RT- PCR mt bc trờn mu chun (quy trỡnh...
  • 54
  • 497
  • 1

Xem thêm

Từ khóa: nghiên cứu làm hàm giả tháo lắp toàn bộ có sử dụng kỹ thuật lấy dấu sơ khởi đệm và lấy dấu vành khítnckhspud sử dụng kỹ thuật đặt câu hỏi để nâng cao chất lượng dạy học phần một số vấn đề của châu lục và khu vực trong chương trình địa lí lớp 11 thptnghiên cứu xác định se as trong mẫu máu và nước tiểu bằng phương pháp hấp thụ nguyên tử sử dụng kỹ thuật hidrua hoálợi ích và những hạn chế của việc sử dụng kỹ thuật gissử dụng kỹ thuật gen trong chẩn đoán và điều trịsử dụng kỹ thuật gen trong chẩn đoán bệnh cây trồng và thực phẩm chuyển genbước 2 lựa chọn và sử dụng kỹ thuật lập trình quỹ đạo mục tiêu trang bị cho người học về mục đích sử dụng kỹ thuật chuyền bóng phương pháp giảng dạy và các sai lầm thường mắc phảimục tiêu trang bị cho người học về mục đích sử dụng kỹ thuật phát bóng phương pháp giảng dạy và các sai lầm thường mắc phải và hệ thống các bài tập mục tiêu trang bị cho người học về mục đích sử dụng kỹ thuật đập bóng nguyên lý các kỹ thuật đập bóng phương pháp giảng dạy và các sai lầm thường mắc phải và hệ thống các bài tậpcác vật liệu thiết bị sử dụng cho kỹ thuật rt pcr để phân lập virus ibsử dụng kỹ thuật kết thúc phụ trong bán hàng và môi giới bất động sảnrất nhạy với offset tần số và khuếch đại phi tuyến vì sử dụng kỹ thuật đa sóng mangđánh giá thực trạng hiệu quả sử dụng kỹ thuật cầm bóng qua người nhảy ném rổ ở cự ly trung bình và gần cho nữ vđv bóng rổ lứa tuổi 16 18 tỉnh bắc giangthực trạng hiệu quả sử dụng kỹ thuật cầm bóng qua người nhảy ném rổ ở cự ly trung bình và gần cho nữ vđv bóng rổ lứa tuổi 16 18 tỉnh bắc giangThông tư 231 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí trong lĩnh vực bảo vệ thực vật do Bộ Tài chính ban hànhThông tư 246 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí kiểm tra, đánh giá, cấp giấy chứng nhận quốc tế về an ninh tàu biển do Bộ trưởng Bộ Tài chính ban hànhThông tư 215 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí cung cấp thông tin doanh nghiệp, lệ phí đăng ký doanh nghiệp do Bộ trưởng Bộ Tài chính ban hànhThông tư 209 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí thẩm định dự án đầu tư xây dựng, phí thẩm định thiết kế cơ sở do Bộ trưởng Bộ Tài chính ban hànhThông tư 260 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí thẩm định nội dung văn hóa phẩm xuất khẩu nhập khẩu do Bộ trưởng Bộ Tài chính ban hànhThông tư 284 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí, lệ phí trong lĩnh vực quản lý chất lượng vật tư nuôi trồng thủy sản do Bộ trưởng Bộ Tài chính ban hànhThông tư 277 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí trong lĩnh vực dược, mỹ phẩm do Bộ trưởng Bộ Tài chính ban hànhThông tư 272 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí, lệ phí trong lĩnh vực chứng khoán do Bộ trưởng Bộ Tài chính ban hànhThông tư 292 2016 TT-BTC hướng dẫn cập nhật kiến thức hàng năm cho kế toán viên hành nghề và người đăng ký hành nghề dịch vụ kế toán do Bộ trưởng Bộ Tài chính ban hànhThông tư 42 2016 TT-BYT quy định việc thừa nhận kết quả phân loại trang thiết bị y tế do Bộ trưởng Bộ Y tế ban hànhThông tư 274 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí hải quan và lệ phí hàng hóa, phương tiện quá cảnh do Bộ trưởng Bộ Tài chính ban hànhThông tư 289 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí, lệ phí trong lĩnh vực điện ảnh do Bộ trưởng Bộ Tài chính ban hànhDATN LAP HO SO DU THAU DHXDHệ thống quản lý cơ sở dữ liệu quản lý cán bộThông tư 39 2016 TT-BGTVT quy định Danh mục sản phẩm, hàng hóa có khả năng gây mất an toàn thuộc trách nhiệm quản lý nhà nước của Bộ Giao thông vậnThông tư 305 2016 TT-BTC quy định mức thu, chế độ thu, nộp, quản lý và sử dụng phí dịch vụ duy trì hệ thống kiểm tra trạng thái chứng thư số do Bộ trưởng Bộ Tài chính ban hànhĐánh giá hiện trạng và đề xuất các giải pháp quản lý chất thải rắn sinh hoạt thị trấn Pác Miầu huyện Bảo Lâm tỉnh Cao BằngThông tư 321 2016 TT-BTC về Quy chuẩn kỹ thuật quốc gia đối với phao tròn cứu sinh dự trữ quốc gia do Bộ trưởng Bộ Tài chính ban hànhThông tư 38 2016 TT-BTNMT quy định kỹ thuật đánh giá chất lượng tài liệu thủy văn do Bộ trưởng Bộ Tài nguyên và Môi trường ban hànhThông tư 39 2016 TT-BTTTT quy định về hợp đồng theo mẫu, điều kiện giao dịch chung trong lĩnh vực viễn thông do Bộ trưởng Bộ Thông tin và Truyền thông ban hành