coordinate point plots y 001

một vài chú ý khi sử dụng trình chiếu Power Point

một vài chú ý khi sử dụng trình chiếu Power Point
... nhuần nhuyễn, trình chiếu không trục trặc - Phối hợp nhịp nhàng trình chiếu với ghi bảng, ghi vở, ăn khớp slide với lời giảng, hoạt động thầy - trò, với tiến trình dạy - Nhịp độ trình chiếu triển ... Phát huy tác dụng bật CNTT mà bảng đen ĐDDH khác khó đạt Các tiêu chí xây dựng dựa sở đúc rút từ kinh nghiệm thực tế dạy học có ứng dụng CNTT cấp THCS THPT Về vấn đề giáo án điện tử có vài suy nghỉ ... tử có vài suy nghỉ : - Bạn nên dành thời gian tối đa 20 phút cho việc sử dụng máy, tương ứng với từ đến slide - Mỗi slide trình bày tiêu đề (cở chữ 26 đến 30), thí nghiệm, hình ảnh trọng tâm...
  • 2
  • 782
  • 8

Nhung luu y khi su dung Power Point

Nhung luu y khi su dung Power Point
... để th y trò làm việc * Nếu có điều kiện, sau soạn xong, bạn nên copy cho học sinh y u cầu em soạn trước nội dung vào thẳng slide theo câu hỏi bạn đề * Nói chung " chương trình" hay hay thiệt ... học - HS thực hành-luyện tập (RLKN) - Đánh giá kết d y - Phát huy tác dụng bật CNTT mà bảng đen ĐDDH khác khó đạt Các tiêu chí x y dựng dựa sở đúc rút từ kinh nghiệm thực tế d y học có ứng dụng ... THPT Về vấn đề giáo án điện tử có vài suy nghỉ : - Bạn nên dành thời gian tối đa 20 phút cho việc sử dụng m y, tương ứng với từ đến slide - Mỗi slide trình b y tiêu đề (cở chữ 26 đến 30), thí nghiệm,...
  • 2
  • 369
  • 0

Tài liệu FCI MT Series Multi-Point – Ý tưởng cho việc kiểm soát lưu lượng khí thải liên tục cho ngành năng lượng ppt

Tài liệu FCI MT Series Multi-Point – Ý tưởng cho việc kiểm soát lưu lượng khí thải liên tục cho ngành năng lượng ppt
... vùng kiểm soát hợp lý Các ứng dụng điển hình (Typical Applications)      Giám sát ống khói cho hệ thống kiểm soát khí phát thải liên tục (CEMS) Giám sát lưu lượng khí sơ cấp Giám sát lưu lượng ... thiểu khí phát thải NOx cách kiểm soát xác tỷ lệ khí cấp vào lò để phục vụ việc đốt than Việc đo lường xác lưu lượng khí cấp vào lò khâu quan trọng để tối đa hóa hiệu suất đạt MT series Hãng FCI ... kiện mà dòng lưu lượng khí phân bố không ống dẫn Trường hợp loại Single-point cho tín hiệu đầu 90% lưu lượng khí thực tế đầu vào (sai số 10%) Trong MT series đo xác cho 100% lưu lượng khí vào Trường...
  • 7
  • 430
  • 0

Tài liệu FCI MT Series Multi-Point – Ý tưởng cho việc kiểm soát lưu lượng khí thải liên tục trong ngành năng lượng pdf

Tài liệu FCI MT Series Multi-Point – Ý tưởng cho việc kiểm soát lưu lượng khí thải liên tục trong ngành năng lượng pdf
... vùng kiểm soát hợp lý Các ứng dụng điển hình (Typical Applications)      Giám sát ống khói cho hệ thống kiểm soát khí phát thải liên tục (CEMS) Giám sát lưu lượng khí sơ cấp Giám sát lưu lượng ... kiện mà dòng lưu lượng khí phân bố không ống dẫn Trường hợp loại Single-point cho tín hiệu đầu 90% lưu lượng khí thực tế đầu vào (sai số 10%) Trong MT series đo xác cho 100% lưu lượng khí vào Trường ... thiểu khí phát thải NOx cách kiểm soát xác tỷ lệ khí cấp vào lò để phục vụ việc đốt than Việc đo lường xác lưu lượng khí cấp vào lò khâu quan trọng để tối đa hóa hiệu suất đạt MT series Hãng FCI...
  • 7
  • 223
  • 0

Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps

Báo cáo y học:
... CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Mice were injected intraperitoneally ... increase in safranin O staining intensity in the patella on day When the data of all time points were pooled, a significant increase in safranin O staining was observed The tibial cartilage, however, ... computerized imaging system BMP-2 was compared to controls and shows an increase in VDIPEN staining on days and in patellar cartilage, which was only significant and most prominent on day The elevated...
  • 11
  • 237
  • 0

Báo cáo y học: " Advances in the genetics of rheumatoid arthritis point to subclassification into distinct disease subsets" pps

Báo cáo y học:
... level of joint damage in RA is therefore required The increasing comprehension of the role of genetics in disease outcome in RA may promote the development of personalized medicine Although the ... frequently in relation to RA, providing inconsistent results, is a noncoding variant in the 3′ end of the gene encoding for cytotoxic T lymphocyte antigen (CTLA4) [27,28] Combined data from the USA ... none of these associations are convincingly replicated in independent cohorts Moreover, although a recent twin study indicated that genetic factors play a role in determining the severity of RA...
  • 8
  • 219
  • 0

Báo cáo y học: "Changes in Two Point Discrimination and the law of mobility in Diabetes Mellitus patients" pps

Báo cáo y học:
... systematic study of the law of mobility to assess the sensibility of diabetic subjects, comparing the law of mobility of TPD in the upper and lower extremities of DM patients We observe that the ... sensory loss in DM subjects This paper presents the first systematic study of the law of mobility to assess the sensibility of diabetic subjects, comparing the law of mobility of TPD in upper and ... dysfunction [5] Static and dynamic Two- Point Discrimination The minimum distance between two stimulus points on the skin, which are perceived as distinct points, is defined as TPD Among the two...
  • 6
  • 267
  • 0

Báo cáo y học: "Left ventricular diastolic dysfunction of the cardiac surgery patient; a point of view for the cardiac surgeon and cardio-anesthesiologist" pptx

Báo cáo y học:
... coronary artery bypass grafting [48,49] In a similar way, Yamamoto et al by using classical ECHO after coronary artery bypass grafting, showed that DD was characterized by a decrease in E wave ... DD through an increase upon wall thickness (secondary to enlargement of cardiac myocytes), and changes in the vasculature, the diameter, and vascular stiffness of the aorta and large arteries [83] ... multivariate analysis by Bernard et al [13], left ventricular diastolic dysfunction was a better predictor of hemodynamic instability after cardiac surgery compared to systolic dysfunction Treatment...
  • 10
  • 238
  • 0

Báo cáo y học: "Effectiveness of trigger point dry needling for plantar heel pain: study protocol for a randomised controlled trial" pot

Báo cáo y học:
... needling for plantar heel pain: study protocol for a randomised controlled trial Journal of Foot and Ankle Research 2011 4:5 Submit your next manuscript to BioMed Central and take full advantage of: ... ElZarka A, DeLuca J: Efficacy of intra-articular hyaluronan (Synvisc™) for the treatment of osteoarthritis affecting the first metatarsophalangeal joint of the foot (hallux limitus): study protocol ... Woman who are pregnant; iv) Dermatological disease within the dry needling areas; v) A history of dry needling or acupuncture treatment for any condition; vi) Treatment for plantar heel pain...
  • 10
  • 187
  • 0

Báo cáo y học: " Biliary peritonitis caused by a leaking T-tube fistula disconnected at the point of contact with the anterior abdominal wall: a case report" docx

Báo cáo y học:
... (arrow) with diagrammatic representation of relation to biliary anatomy (b) Diagram of fistula pathway and leak mechanism Historically, a latex T-tube has always been used during open exploration, ... has a latex allergy This case is novel since the site of the bile leak was distal, at the point of contact between fistula and anterior abdominal wall Usually biliary leakage occurs through Page ... with the anterior abdominal wall Hepatobiliary surgeons should be aware of this mechanism of biliary leakage and the use of laparoscopy to recannulate the fistula with a satisfactory outcome Consent...
  • 4
  • 183
  • 0

Xem thêm