decimals division various by whole 001

Báo cáo y học: "Mutation discovery in mice by whole exome sequencing" potx

Báo cáo y học:
... Trembath R, Jeffery S: Rapid identification of mutations in GJC2 in primary lymphoedema using whole exome sequencing combined with linkage analysis with delineation of the phenotype J Med Genet ... exome sequencing provides sufficient coverage of flanking intron sequence to positively identify potentially damaging, noncoding mutations in the intron sequences immediately flanking target exons ... Limitations of exome sequencing for mutation discovery Using this technology, we validated putative causative coding mutations in of the 15 mutant exomes examined For the remaining six mutants,...
  • 12
  • 131
  • 0

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học:
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... troglodytes Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... specification of left-right (LR) asymmetry during embryonic development, and can lead to malformation of any organ that is asymmetric along the LR axis Heterotaxy is classically associated with heart...
  • 36
  • 218
  • 0

Glaucoma, by Various docx

Glaucoma, by Various docx
... The Project Gutenberg EBook of Glaucoma, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions ... Edward Jackson, M.D Etiology and Classification of Glaucoma, Discussion, Francis Lane, M.D Pathology of Glaucoma, John Elmer Weeks, M.D Pathology of Glaucoma, Discussion, E V L Brown, M.D Concerning ... Black, M.D Trephining for Glaucoma, Robert Henry Elliot, M.D Trephining for Glaucoma, Discussion, Frank C Todd, M.D Operations Other Than Scleral Trephining for the Relief of Glaucoma, Casey A Wood,...
  • 259
  • 233
  • 0

Xem thêm

Từ khóa: Quyết định 2800 QĐ-UBND bổ sung Kế hoạch sử dụng đất năm 2016 huyện Tứ Kỳ, tỉnh Hải DươngQuyết định 939 QĐ-UBND năm 2016 về mã định danh phục vụ kết nối hệ thống quản lý văn bản và điều hành của cơ quan hành chính nhà nước tỉnh Gia LaiQuyết định 1538 QĐ-UBND năm 2016 phê duyệt Quy hoạch chung xây dựng tỷ lệ 1 5.000 Đô thị Phố Cà, huyện Thanh Liêm, tỉnh Hà NamQuyết định 70 2016 QĐ-UBND Quy chế mua sắm tài sản nhà nước theo phương thức tập trung trên địa bàn tỉnh Thừa Thiên HuếQuyết định 2756 QĐ-UBND năm 2016 về Đề án sản xuất vụ Xuân, vụ Hè năm 2017 do tỉnh Thái Bình ban hànhQuyết định 3101 QĐ-UBND năm 2016 về xếp hạng di tích lịch sử do tỉnh Quảng Bình ban hànhQuyết định 53 2016 QĐ-UBND quy định mức hỗ trợ cho hoạt động khuyến công trên địa bàn tỉnh Lâm ĐồngQuyết định 25 2016 QĐ-UBND bãi bỏ Quyết định 46 2012 QĐ-UBND Quy định về thực hiện công khai, minh bạch trong hoạt động thanh tra và giải quyết khiếu nại, tố cáo trên địa bàn tỉnh Khánh HòaQuyết định 1602 QĐ-UBND năm 2016 phê duyệt danh mục nhiệm vụ khoa học và công nghệ cấp tỉnh thực hiện năm 2017 do tỉnh Bắc Giang ban hànhQuyết định 23 2016 QĐ-UBND Quy định về quản lý, sử dụng nhà chung cư trên địa bàn tỉnh Khánh HòaQuyết định 3016 QĐ-UBND năm 2016 về thành lập Ban chỉ đạo Tổng điều tra kinh tế năm 2017 tỉnh Khánh HòaQuyết định 520 QĐ-UBDT năm 2016 thành lập Viện Nghiên cứu văn hóa dân tộc thuộc Học viện Dân tộc do Bộ trưởng, Chủ nhiệm Ủy ban Dân tộc ban hànhQuyết định 521 QĐ-UBDT năm 2016 thành lập Trung tâm Thông tin - Thư viện thuộc Học viện Dân tộc do Bộ trưởng, Chủ nhiệm Ủy ban Dân tộc ban hànhQuyết định 522 QĐ-UBDT năm 2016 thành lập Tạp chí Nghiên cứu dân tộc thuộc Học viện Dân tộc do Bộ trưởng, Chủ nhiệm Ủy ban Dân tộc ban hànhQuyết định 3135 QĐ-UBND năm 2016 về thành lập Văn phòng công tác biến đổi khí hậu thành phố Cần ThơQuyết định 49 2016 QĐ-UBND Danh mục và phân cấp quản lý tuyến đường thủy nội địa trên địa bàn tỉnh Tiền GiangQuyết định 150 QĐ-UBND-TL năm 2016 thành lập Ban Chỉ đạo Tổng điều tra kinh tế tỉnh Đồng Tháp năm 2017Quyết định 4127 QĐ-UBND năm 2016 phê duyệt Điều lệ Hội Quần vợt huyện Tân Trụ, tỉnh Long An nhiệm kỳ II (2016-2021)Quyết định 1306 QĐ-UBND năm 2016 về thành lập Hội đồng thẩm định kế hoạch sử dụng đất năm 2017 của các huyện, thành phố tỉnh Ninh BìnhQuyết định 1595 QĐ-UBND năm 2016 bổ sung bảng giá tính lệ phí trước bạ theo Quyết định 1016 QĐ-UBND do tỉnh Hà Nam ban hành