decimals division tenthousandth by whole 001

Báo cáo y học: "Mutation discovery in mice by whole exome sequencing" potx

Báo cáo y học:
... Trembath R, Jeffery S: Rapid identification of mutations in GJC2 in primary lymphoedema using whole exome sequencing combined with linkage analysis with delineation of the phenotype J Med Genet ... exome sequencing provides sufficient coverage of flanking intron sequence to positively identify potentially damaging, noncoding mutations in the intron sequences immediately flanking target exons ... Limitations of exome sequencing for mutation discovery Using this technology, we validated putative causative coding mutations in of the 15 mutant exomes examined For the remaining six mutants,...
  • 12
  • 131
  • 0

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học:
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... troglodytes Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... specification of left-right (LR) asymmetry during embryonic development, and can lead to malformation of any organ that is asymmetric along the LR axis Heterotaxy is classically associated with heart...
  • 36
  • 218
  • 0

báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx

báo cáo hóa học:
... extraction ELISA and Elispot assays Antibody response to HBs Ag was evaluated by ELISA assays (Architect System, Abbott, Sligo, Ireland) in sera from naïve or vaccinated donors Page of (page ... minimal equipment and time requirements Furthermore, automation of this method could be advantageously utilized for fast and accurate quantitative monitoring of natural or vaccination induced cellular ... post-vaccination Figure WB monitoring of cellular immune response to vaccination against influenza virus WB monitoring of cellular immune response to vaccination against influenza virus Eight healthy...
  • 9
  • 205
  • 0

Báo cáo hóa học: " Observation of strong anisotropic forbidden transitions in (001) InGaAs/GaAs single-quantum well by reflectance-difference spectroscopy and its behavior under uniaxial strain" potx

Báo cáo hóa học:
... al.: Observation of strong anisotropic forbidden transitions in (001) InGaAs/GaAs single-quantum well by reflectance-difference spectroscopy and its behavior under uniaxial strain Nanoscale Research ... that of the other samples, which results in much stronger IPOA The appearance of the forbidden transition and its behavior under uniaxial strain can be interpreted in a similar way According to ... spin-orbit split-off (SO) band [18] Therefore, taking into account the coupling between hh, lh and SO band, we use band K · P theory which is described in Ref [18], and treat the holemixing induced...
  • 10
  • 80
  • 0

Báo cáo hóa học: "Alloying and Strain Relaxation in SiGe Islands Grown on Pit-Patterned Si(001) Substrates Probed by Nanotomography" doc

Báo cáo hóa học:
... determining strain relaxation and therefore in defining the compositional profiles of the islands Experimental Procedure The sample considered here consists of 8.5 monolayer of Ge deposited by molecular ... concentration increases monotonically for islands forming randomly on a flat surface, while it tends to a constant xGe = 0.4 for islands on the patterned substrate This result provides an independent confirmation ... datasets is obtained, as shown in Fig 1d, choosing d * 0.87 It can be therefore concluded that the strain in site-controlled islands is reduced by about 10% with respect to islands grown on the planar...
  • 5
  • 81
  • 0

Xem thêm

Từ khóa: Quyết định 1799 QĐ-UBND năm 2016 công bố thủ tục hành chính lĩnh vực nghệ thuật biểu diễn thuộc phạm vi chức năng quản lý của Sở Văn hóa, Thể thao và Du lịch tỉnh Cà MauQuyết định 75 2016 QĐ-UBND về phân cấp, ủy quyền cho Ban Quản lý Khu Kinh tế, công nghiệp tỉnh Thừa Thiên HuếQuyết định 34 2016 QĐ-UBND về quy định mức thu tiền sử dụng khu vực biển để khai thác, sử dụng tài nguyên biển trên địa bàn tỉnh Kiên GiangQuyết định 3093 QĐ-UBND phê duyệt điều chỉnh, bổ sung kế hoạch sử dụng đất năm 2016 của huyện Sông Lô - tỉnh Vĩnh PhúcQuyết định 37 2016 QĐ-UBND Quy định về quản lý và sử dụng quỹ đất do Nhà nước quản lý trên địa bàn tỉnh Bình DươngNghị quyết 64 NQ-HĐND năm 2016 phê chuẩn Quyết toán thu, chi ngân sách địa phương năm 2015 do Hội đồng nhân dân tỉnh Lai Châu ban hànhNghị quyết 106 2016 NQ-HĐND quy định mức thu, chế độ thu nộp, quản lý và sử dụng lệ phí đăng ký kinh doanh trên địa bàn tỉnh Đồng ThápNghị quyết 101 2016 NQ-HĐND quy định mức thu, chế độ thu, nộp, quản lý và sử dụng lệ phí cấp chứng minh nhân dân trên địa bàn tỉnh Đồng ThápNghị quyết 100 2016 NQ-HĐND quy định mức thu, chế độ thu, nộp, quản lý và sử dụng lệ phí đăng ký cư trú trên địa bàn tỉnh Đồng ThápQuyết định 1761 QĐ-TCHQ về thực hiện phát triển quan hệ đối tác Hải quan - Doanh nghiệp trong ngành Hải quanQuyết định 715 QĐ-BXD điều chỉnh đề án tái cấu trúc, nâng cao năng lực Tổng công ty Lắp máy Việt NamGiáo án giảng dạy chuẩn theo chương trình Bộ GD_ĐT Đại số 12 Cơ bảnQuyết định 3206 QĐ-UBND về khung giá dịch vụ nhà chung cư trên địa bàn thành phố hà nộiQuyết định 1194 QĐ-BTC về thủ tục hành chính trong lĩnh vực Quản lý thuếQuyết định 5855 QĐ-BCT về điều chỉnh địa điểm xây dựng cửa hàng xăng dầu tuyến đường Hồ Chí MinhQuyết định 34 2016 QĐ-UBND về quy định giá tính thuế tài nguyên trên địa bàn tỉnh Hậu Giang năm 2016Quyết định 2434 QĐ-UBND năm 2016 phê duyệt Chương trình xúc tiến thương mại tỉnh Hải Dương giai đoạn 2016-2020Quyết định số 276 QĐ-TCTS-NTTS công nhận dòng tôm thẻ chân trắng bố mẹ thế hệ G3 là giống nuôi trồng thủy sản mới.Quyết định 628 QĐ-BNV Phê duyệt Đề án hợp tác quốc tế của Trường Đào tạo, bồi dưỡng cán bộ, công chứcKế hoạch số 734 KH-BGDĐT rà soát, điều chỉnh chương trình giáo dục mầm non