0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Metabolism Fueling Cell Growth

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
  • 14
  • 517
  • 0
Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

... shown) Inhibition of pneumococcal murein hydrolases by bicyclic amines As shown above, tropic esters of bicyclic amines were selected and characterized by biophysical methods as strong ligands ... that the bicyclic amines are also able to bind to the active site of Pce Effect of choline analogs on cell growth and viability Fig Effect of choline and analogs on the activity of cell wall ... by CD Fig Spectroscopic analysis of ligand binding to C-LytA (A) Conformational changes induced by ligands on C-LytA monitored by near-UV CD with no ligand added (—) and upon addition of ligands:...
  • 13
  • 465
  • 0
Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

... 5541 MiR-9 inhibits ovarian cancer cell growth L.-M Guo et al Fig Dysregulation of NF-jB1 in ovarian cancer tissue samples The NF-jB1 expression level in the four pairs of human ovarian cancer tissue ... affects ovarian cell growth activity over the long term, because the inhibi5542 Fig Knockdown of NF-jB1 inhibits growth of ES-2 cells in vitro (A) The validity of pSilencer ⁄ si -NF-jB1 (si -NF-jB1) ... be markedly downregulated in ovarian cancers, and 5538 Fig Dysregulation of miR-9 in ovarian cancer tissues The miR-9 expression level of four pairs of human ovarian cancer tissue samples (Ca)...
  • 10
  • 413
  • 0
báo cáo hóa học:

báo cáo hóa học:" Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth" pot

... article as: Yallapu et al., Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth Journal of Ovarian Research 2010, 3:11 ... of cisplatin treatment in cisplatin resistant cells by increasing the sensitivity of cells to apoptotic pathways and modulating nuclear β-catenin signaling Curcumin is in early phase clinical trials ... mechanisms involved in curcumin mediated chemo/radio-sensitization in ovarian cancer cells Materials and methods Cell culture and drugs A2780 and A2780CP (resistant to cisplatin) paired cells [18]...
  • 12
  • 334
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt

... Schwann cells maintain a constant average size with repeated passaging We purified Schwann cells from postnatal day rat sciatic nerve by sequential immunopanning We maintained the cells in a proliferative ... big mammalian cells have been observed to grow faster than small cells of the same type and at the same point of the cell cycle It thus seems likely that most mammalian cells grow linearly, independent ... (Boehringer Mannheim) and using a micro-BCA (bicinchoninic acid) assay with a bovine serum albumin (BSA) standard Analysis of protein synthesis and degradation rates About 105 quiescent cells...
  • 10
  • 422
  • 0
Báo cáo y học:

Báo cáo y học: "The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease" potx

... regulating IVD cell behaviour In this study, we have examined the relative influence of serum, glucose, and oxygen supply, singly or combined, on the growth pattern of bovine IVD cells Since the nutrient ... levels of oxygen and in medium supplemented with 20% FCS and 320 mg/dL glucose Cell proliferation and cell viability Monolayers were harvested by trypsinisation and viable cell counts were performed ... Figure in monolayer and alginate culture systems, are summarised in Table The minimal influence of oxygen levels on IVD cell growth and behaviour is omitted from this summary Discussion alginate...
  • 8
  • 324
  • 0
Báo cáo y học:

Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in CP70 cells also increased huntingtin levels, ... Trip10- overexpressing IMR-32 cells (Figure 4A) On the other hand, huntingtin increases cell death by promoting apoptosis Thus, high levels of huntingtin in Trip10overexpressing CP70 cells may lead to cell...
  • 10
  • 438
  • 1
Báo cáo y học:

Báo cáo y học: " Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos" pptx

... Lu et al.: Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos Journal of Biomedical Science 2011 18:73 Submit your next ... proliferation in vitro [30] Our results revealed tbx5 insufficiency ultimately resulted in activation of apoptosis and inhibition of cell growth in whole individual of zebrafish embryo, though knockdown of ... transcription factor, in zebrafish embryos may trigger multiple signal pathways including promoting or inhibiting molecules and eventually come to the end sequel of apoptosis and cease of cell growth Besides,...
  • 10
  • 592
  • 0
báo cáo khoa học:

báo cáo khoa học: "Phenylhexyl isothiocyanate has dual function as histone deacetylase inhibitor and hypomethylating agent and can inhibit myeloma cell growth by targeting critical pathways" doc

... suppresses growth and causes cell cycle arrest of RPMI8226 myeloma cells PHI suppresses growth and causes cell cycle arrest of RPMI8226 myeloma cells (A) PHI suppresses growth of RPMI8226 myeloma cells ... position was indicated PHI inhibits histone deacetylation We have previously shown that PHI can inhibit the histone deacetylase and induces histone hyperacetylation in HL-60 leukemia cells and prostate ... Phase I trial of the histone deacetylase inhibitors, depsipeptid (FR901228) in patients with refractory neoplasms Clinical Cancer Res 2002, 8(3):718-728 Melnick A, Licht JD: Histone Deacetylases...
  • 10
  • 295
  • 0
báo cáo khoa học:

báo cáo khoa học: "Effect of arginase II on L-arginine depletion and cell growth in murine cell lines of renal cell carcinoma" pptx

... 0.017, L-arginine depletion by arginase II induces CD3ζ downregulation in Jurkat T-cells Jurkat T-cells rapidly lose CD3ζ in absence of L-arginine Therefore, we tested if L-arginine depletion by ... Conclusion Arginase II produced by renal cell carcinoma cells can modulate L-arginine levels to regulate both cell growth and T cell function Blocking arginase may lead to a decrease in RCC cell ... blocks arginase activity and L-arginine consumption in CL-19 cell line Since nor-NOHA significantly inhibited cell proliferation of CL-19, we wanted to test the effect of this inhibitor on arginase...
  • 10
  • 388
  • 0
báo cáo khoa học:

báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot

... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin BMC Plant Biology 2011 ... http://www.biomedcentral.com/1471-2229/11/128 of the evolution of genes involved in cell wall formation in green algae and land plants Cell walls have played crucial roles in the colonization of land by plants [63,64]...
  • 17
  • 562
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ