18090 antonyms cards for tpr activity

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... the contribution of the N- and C-terminal regions of GCPII to its enzymatic properties and structure /folding The results clearly show that the amino acids at the extreme C-terminus of GCPII are ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... the length of an epitope attached The sequence at the N-terminus of the protein was also shown to be required for the activity and/ or secretion of the GCPII carboxypeptidase As for the N-terminally...
  • 9
  • 197
  • 0

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon structures in Xenopus ... 2002 Functional analysis of Xenopus MGP gene promoter (Eur J Biochem 269) 1949 GGAAAC-3Â) for amplication of the region from )783 to +33, and (5Â-CCGGAGCTCGAGGGAGATGAGGAG GTGTGG-3Â) for amplication ... AGATCTACCACACCTCCTCATCTCC-3Â) for amplication of the region from )180 to )36 and (5Â-GAAGAT CTAACTAGATTTTACCATTGG-3Â) for amplication of the region from )180 to )72, respectively The )134/ )36TATALUC construct was PCR amplied...
  • 10
  • 220
  • 0

Báo cáo khoa học: Mutational analyses of human eIF5A-1 – identification of amino acid residues critical for eIF5A activity and hypusine modification doc

Báo cáo khoa học: Mutational analyses of human eIF5A-1 – identification of amino acid residues critical for eIF5A activity and hypusine modification doc
... there is no information available as to which parts of the eIF5A molecule and the ribosome are involved in the interaction The identification of amino acid residues critical for eIF5A activity is ... Lys47, Gly49 and Gly52 of the hypusine loop) that are critical for eIF5A activity, independently of the deoxyhypusine ⁄ hypusine modification Our data demonstrate that both N-terminal and C-terminal ... requirement for deoxyhypusine ⁄ hypusine modification for eIF5A activity previously demonstrated using the yeast eIF5A mutant K51R (Lys51 is the hypusine modification site of yeast eIF5A) [8] is...
  • 15
  • 145
  • 0

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot
... influence the protonation state of the carboxyl group of their side-chain [7] The aim of the present study was to express Gas1p at high levels for biochemical and structural characterization of the protein ... acid residues are essential for the two-step activity (Fig 6B,C) In addition, the sGas1482-H protein was analyzed for activity before and after removal of the N-linked chains by Endo H The complete ... wild-type Gas1p or the Gas1- C74S mutant were labelled for with [35S]methionine and the behaviour of the labelled forms was monitored at different time-points after the chase (Fig 7B) The ER form of Gas1p...
  • 11
  • 219
  • 0

Báo cáo khóa học: Modified colorimetric assay for uricase activity and a screen for mutant Bacillus subtilis uricase genes following StEP mutagenesis pptx

Báo cáo khóa học: Modified colorimetric assay for uricase activity and a screen for mutant Bacillus subtilis uricase genes following StEP mutagenesis pptx
... mutants, designated B4 and B8, had uricase activity Analyzing the motif sequence of mutant uricase Two active variants (B4 and B8) were analyzed by sequence analysis and found to have identical nucleotide ... chromatography of purification and an activity assay by spectrophotometry We have demonstrated the usefulness of this assay and used it to screen for a mutant uricase enzyme The StEP recombination ... that both wild-type and mutant uricase are at optimal activity at pH values from to 10 (Fig 9) Discussion This study describes a modified colorimetric assay for uric acid in which uricase catalyzes...
  • 7
  • 158
  • 1

Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx

Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx
... subsite )2 and this subsite had the highest binding affinity among the glycone subsites [17], we investigated the role of Trp58 in the activity of HSAmy For this, mutants Trp58 fi Ala (W58A), Trp58 ... reason for the absence of binding at subsites in the crystal structure of acarbose-soaked human pancreatic a-amylase mutant D300N [12] It is known that a-amylases, can display transglycosylation activity ... During a transglycosylation reaction, the glycosyl covalent intermediate is Ó FEBS 2004 Trp58 mutants at subsite )2 of human salivary a-amylase (Eur J Biochem 271) 2525 chemistry for producing oligosaccharides...
  • 13
  • 188
  • 0

Báo cáo khoa học: Role of conformational flexibility for enzymatic activity in NADH oxidase from Thermus thermophilus pptx

Báo cáo khoa học: Role of conformational flexibility for enzymatic activity in NADH oxidase from Thermus thermophilus pptx
... conformation of proteins because the enzyme activity of a number of proteins is unaffected in the presence of acrylamide [29] Discussion Activation of NADH oxidase is caused by an increase in the conformational ... group of FAD [10] Tryptophan residues in the monomeric form of NADH oxidase are spatially separated from the location of the avin cofactor The distance between N1 of the avin cofactor and Ne1 of ... of a tryptophan residue towards the avin cofactor is possible only in the dimeric structure of NADH oxidase None of the tryptophan residues is close to the binding site of the avin cofactor in...
  • 11
  • 196
  • 0

Báo cáo khoa học: UMP kinase from the Gram-positive bacterium Bacillus subtilis is strongly dependent on GTP for optimal activity potx

Báo cáo khoa học: UMP kinase from the Gram-positive bacterium Bacillus subtilis is strongly dependent on GTP for optimal activity potx
... Another striking characteristic of B subtilis UMP kinase is its high requirement for GTP for full catalytic activity, an effect antagonized by UTP This property is shared by UMP kinase from other ... question arises: can the concentration of GTP and UTP play a role in the metabolism of B subtilis in vivo? From the total concentration of different NTPs and Mg2+ in B subtilis, [47,48], it is conceivable ... structure of UMP kinase from Bacillus subtilis One monomer is shown in CPK representation Colours (from blue to violet) indicate residue conservation (weakly to strongly) as computed by CONSURF [35]...
  • 9
  • 101
  • 0

báo cáo hóa học:" A comprehensive systematic review of the development process of 104 patient-reported outcomes (PROs) for physical activity in chronically ill and elderly people" pptx

báo cáo hóa học:
... Adaptation and experts 1% Patients and adaptation and literature (unsystematic search) 1% Patients and experts and adaptation 1% Significant others and literature (unsystematic search) and adaptation ... A comprehensive systematic review of the development process of 104 patient-reported outcomes (PROs) for physical activity in chronically ill and elderly people Anja Frei1,2§, Kate Williams3, ... Patients and experts 3.8% Experts only 2.9% Experts and adaptation and literature (unsystematic search) 1.9% Patients and adaptation 1.9% Adaptation and literature (systematic search) 1% Adaptation...
  • 47
  • 157
  • 0

Báo cáo hóa học: " Research Article Combination of Accumulated Motion and Color Segmentation for Human Activity Analysis" ppt

Báo cáo hóa học:
... shift color segmentation In Figure 9(g) we see the results of color segmentation on the activity areas of a frame of the video sequence After comparing and matching the color histograms of the color ... (b) (c) Activity area for table tennis, frames 10–20 Activity area for table tennis, frames 1–20 Color segmentation in the activity area (d) (e) (f) Color segmentation for background area Segmentation ... Activity area for frames 31 to 60 (c) Activity area for frames to 60 (d) MEI for tennis serve (e) (f) Color segmentation in the action mask Segmentation result for frame Segmentation result for frame...
  • 20
  • 158
  • 0

Báo cáo khoa học: "Requirement of Metabolic Activation for Estrogenic Activity of Pueraria mirifica" pps

Báo cáo khoa học:
... Saag P T., van der Burg B., and Gustafsson J-A, Interaction of estrogenic Requirement of Metabolic Activation for Estrogenic Activity of Pueraria mirifica 277 12 13 14 15 16 chemicals and phytoestrogens ... reagent (Promega) was added and Renilla luciferase activity was determined Using the DLRTM Requirement of Metabolic Activation for Estrogenic Activity of Pueraria mirifica 275 Assay System (Promega), ... capability to metabolically activate PM by the lack of mammalian metabolic enzymes using HepG2 human hepatoma cell would be able to know whether PM is metabolized before induction of estrogenic activity...
  • 5
  • 114
  • 0

Báo cáo y học: "Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution" ppt

Báo cáo y học:
... solution assay for integrase joining Moderate- throughput solution assay for integrase joining activity Panel A Principles of a solution assay to measure integrase joining activity by fluorescence Labeling ... presence of Mg++ Discussion The joining assay In this report we describe a simplified assay measuring the joining activity for retroviral integrases in solution The assay offers several advantages ... same in the two proteins Finally, the rate of joining by ASV IN is 6–7 fold faster than HIV-1 IN in the presence of either metal cofactor We also demonstrated the utility of the joining assay...
  • 10
  • 209
  • 0

Evaluation of thymoquinone for cytotoxic activity against human breast cancer cell lines and tumor xenograft in nude mice

Evaluation of thymoquinone for cytotoxic activity against human breast cancer cell lines and tumor xenograft in nude mice
... protein expression of several genes of interest in the tumor tissues was examined and these findings were compared with those from cell line studies The antitumor effect of the combination of TQ ... determining the anticancer activities of TQ and its possible mechanisms of action in breast cancer cells, our next interest was to examine these effects in an animal model Breast tumor xenograft ... number and size of aberrant crypt foci in 1,2-dimethyl hydrazine-induced colon cancer in mice (Gali-Muhtasib et al., 2008b) Oral administration of TQ inhibited forestomach tumor incidence and multiplicity...
  • 176
  • 81
  • 0

Xem thêm