0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Symmetry in mathematics and mathematics of symmetry

ARSENIC POLLUTION IN SOIL AND GROUNDWATER OF BANGLADESH

ARSENIC POLLUTION IN SOIL AND GROUNDWATER OF BANGLADESH

... In Groundwater Of Bangladesh Field experience and available data shows that both soil and under groundwater of a vast area of Bangladesh has been threatened with arsenic contamination affecting ... Preliminary Results of Groundwater investigation in Arsenic affected areas in Bangladesh A Report Prepared by RGAG Japan RGAG(1999) Arsenic contamination of ground water in Bangladesh Interim ... A.W, Ahmad, Sk A and Hadi, Sk A.(1997) The arsenic pollution of ground water in Samta, Jessore, Bangladesh Bilateral Consultation between Bangladesh and India on Arsenic in Drinking Water, WHO/SEARO,...
  • 7
  • 361
  • 0
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable – In grid networks (with high bandwidth-delay product) ... shortcomings of TCP • We explained the design rationale and implementations details in this paper Future Work • Bandwidth Estimation • CPU utilization – Self-clocking – Code optimization • Theoretical...
  • 32
  • 580
  • 0
Tài liệu Sounding the Event- Escapades in dialogue and matters of art, nature and time doc

Tài liệu Sounding the Event- Escapades in dialogue and matters of art, nature and time doc

... restless times from which comes background noise? Yes, how is such an image to greet the murmuring and the crackling and the tinkling and the crying and the sighing and rumbling and the roaring of ... birds and tree There was the agitation, the vacillation, the vibration There was, also, the movement of the time that made the time of day, the time of early evening And moreover, there was the ... ruckus in the midst of these dividing water^.'^ The English took the sense of sound while the French kept the battle, and going further back you will hear, in the original Latin, the heaving of water...
  • 206
  • 499
  • 0
Tài liệu Good practices in planning and management of integrated commercial poultry production in South Asia ppt

Tài liệu Good practices in planning and management of integrated commercial poultry production in South Asia ppt

... Good practices in planning and management of integrated commercial poultry production in South Asia by R Prabakaran Professor of Poultry Science Tamil Nadu Veterinary and Animal Science ... researchers and those involved in development in general Good Practices in Poultry Production in South Asia Chapter Poultry Industry in South Asia Poultry provides an immense supply of food for ... and ducks Good Practices in Poultry Production in South Asia Chapter Chicken: broiler production Production of chicken meat is growing into the largest component of the poultry industry in India...
  • 98
  • 519
  • 0
Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

Báo cáo khoa học: Stimulation of fibroblast proliferation by neokyotorphin requires Ca2+ influx and activation of PKA, CaMK II and MAPK/ERK pdf

... should induce activation of all protein kinases shown to contribute to the neokyotorphin effect Both PKA and CaMK II are known to be activated by Ca2+ influx, in the case of CaMK II activation is ... established as neokyotorphin- effect mediators in L929 cells, are PKA, CaMK II and MAPK Discussion Fig Effect of lM neokyotorphin and 50 lM 8-Br-cAMP in L929 cells in the presence of MAPK or CaMK II inhibitors ... Ca2+ influx, elevation of the intracellular Ca2+ level and CaMK II activation A generalized scheme of the action of neokyotorphin is given in Fig Regardless of the primary neokyotorphin target...
  • 11
  • 726
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢);...
  • 14
  • 473
  • 0
fraud and responsibilities of auditor in detecting and preventing of fraud

fraud and responsibilities of auditor in detecting and preventing of fraud

... about the responsibilities of both internal and external auditor in detecting and preventing fraud 2.3.1 Responsibilities of internal auditor Internal auditor plays an important role in fraud detection ... fraud and the responsibilities of auditor in detecting and preventing of fraud Fraud can be considered as most concerning problem of the business Because of this have more effect to all most of ... preventing and detecting its 1.2 Objective of research This study is to help the reader to understand some issues that related to fraud and the responsibilities of auditor in preventing and detecting...
  • 56
  • 467
  • 1
FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION pptx

FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION pptx

... Movements: Definitions, Data and Method 46 TURKEY, 1980-2000: FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION I Introduction Integration of the developing national ... extend of disassociation of the productive sphere of the domestic economy from its indigenous processes of accumulation and distribution As internationalization of the commodity and the financial ... targeted rates of change of price indices and of nominal exchange rates Between the last weeks of 1999 and 2000, the exchange rate basket rose by 20.3%; but rates of change in WPI and CPI indices...
  • 73
  • 449
  • 0
comparing two documentaries one day in september and nanook of the north

comparing two documentaries one day in september and nanook of the north

... pieces are informing One day in September is more developed due to time it was produced The two show a big difference in the development of documentaries but I think Nanook was a very influential ... now and what he was like then In comparison One day in September is a better informing piece than Nanook because it uses more factors to keep the audience interested, although both pieces are informing ... difference in the development of documentaries but I think Nanook was a very influential film to start of the documentary genre ...
  • 2
  • 421
  • 0
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

... of the diagnosis intervals and initiation of treatment intervals with respect to days One hundred and three patients (50.5%) had delays in diagnosis and 51 patients (25%) had delays in initiation ... Med, 1992; 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural area of Nepal Int J Tuberc Lung Dis, ... Güneylioglu D et al – Delays in pulmonary tuberculosis diagnosis and treatment Table A sub-analysis of patient delay Application interval (days) Mean (SD) Median 95% CI Sex Male Female Age ...
  • 6
  • 466
  • 0
báo cáo hóa học:

báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx

... (IGF1R): Insulin-like Growth Factor- 1 receptor; (IGFBP-3): Insulin-like Growth Factor Binding Protein-3; (IGFBP-4): Insulin-like Growth Factor Binding; Protein-4; (MAPK): Mitogen-activated protein kinase; ... role of secreting IGFBPs in melanoma However, data not support the clinical utility of measuring levels of IGFBP-3 and -4 in sera of melanoma patients Abbreviations (IGF): Insulin-like Growth Factor; ... Cohen P: The role of the insulin-like growth factor binding proteins and the IGFBP proteases in modulating IGF action Endocrinol Metab Clin North Am 1996, 25(3):591-614 Rajaram S, Baylink DJ,...
  • 9
  • 486
  • 0
báo cáo hóa học:

báo cáo hóa học: " Overexpression of serine racemase in retina and overproduction of D-serine in eyes of streptozotocin-induced diabetic retinopathy" docx

... article as: Jiang et al.: Overexpression of serine racemase in retina and overproduction of D -serine in eyes of streptozotocin-induced diabetic retinopathy Journal of Neuroinflammation 2011 8:119 ... of excess retinal D -serine into the ocular humors Compared to those in adult retina, levels of D -serine were easily detected by reverse-phase HPLC in aqueous humor of adult rats, where D -serine ... saline controls found localized to the RGCL and INL in retinas of DR rats (Figure 1D), whereas no staining was detected in retinas of saline controls (Figure 1C) Increased SR expression in retinas...
  • 8
  • 644
  • 0
báo cáo hóa học:

báo cáo hóa học:" Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian cancer" pdf

... deletion or loss -of- function mutations in the survival of motor neuron (SMN) protein results in SMA [12] Gemin and Gemin are shared components of SMN and miRNAcontaining ribonucleoprotein particles ... overexpression of miR-375 resulted in suppressed glucose-stimulated insulin secretion and its inhibition resulted in enhanced insulin secretion Myotrophin, a protein that has a role in exocytosis, ... up-regulated and were down-regulated It was determined that increased expression of miR-181a, miR-181b, and miR-213 in OVCA cell lines results in resistance to doxorubicin and gemcitabine and increased...
  • 9
  • 440
  • 0

Xem thêm

Từ khóa: sounding the event escapades in dialogue and matters of art nature and timepericytes in development and pathology of skeletal muscleheavy metals in soils and plants of serpentine and industrial sites of albaniaethiopia is the oldest independent country in africa and one of the oldest in the worldrole of endothelin in development and therapy of cardiovascular diseasesheet income statement statement of changes in equity and statement of cash flows the following rules shall be followeddetails of exceptional circumstances that justify amending the structure of the balance sheet income statement statement of changes in equity and statement of cash flows for the prior reporting periodgender differences in adoption and use of a healthcare it applicationcausality in pharmacovigilance and expectedness of adverse reactionsplant derived antioxidants and use in prevention and treatment of prostate cancerherbs and bioactive compounds in prevention and treatment of hepatocellular carcinomamass microbial nitrogen microbial purines and 15 n incorporation in microbes and determination of efficiency of microbial protein synthesiscreativity in musicology and philosophy of musicadded—the editor in design and development of online courses 259families in palliative and end of life careNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP