21689 and i love her the beatles

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx
... dose-dependently to isolated recombinant CD11a and CD11b I domains The effective inhibition of binding of ICAM-4 positive red cells by anti -ICAM-4 antibodies, indicate a major role for ICAM-4 in binding of ... possible differences in binding of ICAM-4 and the other two ICAMs for the I domains Many of these mAbs displayed similar inhibitory profiles in assays investigating the effects of the mAbs on the ... binding sites for ICAM-1 and ICAM-2 Further proof for the interaction of ICAM-4 with these I domains was obtained by comparing the ability of recombinant I domain fusion proteins to support the...
  • 14
  • 212
  • 0

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... mansoni NR1 A B W Wu et al DNA binding domain Ligand binding domain Fig Sequence alignment (A) Alignment of DNA binding domain (C domain) and its C-terminal extension (B) Alignment of ligand binding ... assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesocricetus auratus) Cercariae ... conserved, the P-box (EGCKG), which is involved in determining DNA binding specificity, is identical to most members of nuclear receptor subfamily I, for instance retinoic acid receptor (RAR) and vitamin...
  • 16
  • 230
  • 0

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
  • 12
  • 273
  • 0

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
  • 9
  • 185
  • 0

Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt
... examine the effect of the APOH promoter SNPs on plasma b2GPI levels; and (d) to determine the cross-species conservation of the APOH promoter sequence To identify regions of the APOH promoter that ... quantitative change at the protein level Whether the APOH promoter SNPs ()643T>C and )1219G>A) could influence the promoter activity by either the former or latter methods is beyond the scope of in vitro ... highlighted as evolutionary conserved regions (pink rectangles at the top of the graphs) The horizontal axis represents positions in the base genome (human) and the vertical axis represents the...
  • 13
  • 168
  • 0

Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot

Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot
... wells and At the same time, the activity of the muscle was recorded with a pair of electrodes: one electrode was located in the middle, and the other at one end, of the trough Each pair of recording ... from amino-acid sequences Purification and synthesis of I -superfamily conotoxins D-Amino The excitatory peptides r11b and r11c were purified from the venom of the fish-hunting species Conus radiatus ... assay r11b, r11c and their l isomers In the case of r11b, a fivefold difference was observed in potencies of the d-Phe44 and l-Phe44 forms The estimate is based on comparison of the threshold dose...
  • 11
  • 167
  • 0

the beatles and how they changed music

the beatles and how they changed music
... describe The Beatles and John Lennon The Beatles wanted peace, love, and happiness and they gave it not only to Britain but also to the world around them Their music touched everybody’s lives and ... interest in the band In 1964, The Beatles began experimenting with marijuana and later used lots LSD The behind the scene arguments went public and business arrangements failed The Beatles last ... John Lennon, the founder of The Beatles, is one of the Hahn And Donald most influential individual in the music industry John married Cynthia Powell in August of 1962 and became the father of Julian...
  • 3
  • 222
  • 0

Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx

Báo cáo hóa học:
... (Figure 1A) This finding is in keeping with the findings of NS1/NS2 antagonism of type I IFNs [4,46,47] and suggests the possibility that type I IFN antagonism is linked to NS1/NS2 induction of ... interfere with direct TLR signaling, but instead regulate paracrine IFN signaling [7] The SOCS protein family is comprised of eight proteins (CIS, cytokine- inducible SH2-containing protein, SOCS17) of ... activate TLRs and retinoic acid inducible gene I (RIG -I) signaling pathways leading to phosphorylation of interferon regulatory factor3 (IRF3) and IRF7 and stimulation of type I interferon (IFN)...
  • 11
  • 203
  • 0

Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part1 potx

Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part1 potx
... and Financial Audit of the Hawai`i Tourism Authority's Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Conducted by The Auditor State of Hawaii and Nishihama ... www.adultpdf.com The Auditor State of Hawaii OVERVIEW Management and Financial Audit of the Hawai`i Tourism Authority's Major Contracts Report No 03-10, June 2003 Summary Pursuant to Section 23-13, Hawai‘i ... 23, Hawai`i Revised Statutes (HRS), to direct the Auditor to conduct a management and financial audit of all contracts or agreements awarded by the Hawai`i Tourism Authority to a major contractor...
  • 10
  • 178
  • 0

Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part2 pot

Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part2 pot
... Hawai`i Tourism Authority Major contractors Section 23-13, HRS, directs the Auditor to conduct a financial and management audit of the authority’s major contractors.” A major contractor is a ... Specifically, the authority could not justify the contracts it awarded and did not adequately monitor all contracts In 1993, the office conducted a Management and Financial Audit of the Hawai`i Visitors ... monitored the bureau’s contract Objectives of the Audit Assess whether the Hawai`i Tourism Authority adequately manages its major contracts Assess the compliance of major contractors with contract...
  • 10
  • 188
  • 0

Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part3 ppt

Management and Financial Audit of the Hawai`i Tourism Authority’s Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-10 June 2003_part3 ppt
... China and Japan offices indicate varying degrees of improper management of state funds The Kaua‘i Visitor’s Bureau has a staff of four state- funded positions and an executive director who is paid ... HVCB issued a travel and entertainment policy to: provide guidance to travelers, travel arrangers, approvers, and auditors on cost-effective management of travel, entertainment, and other business ... employee was reimbursed $340 for a seven-day car rental because the employee shipped a personal car to Maui in anticipation of an imminent relocation to that island Source: Office of the Auditor This...
  • 10
  • 182
  • 0

Xem thêm