33889 its something that

start something that matters blake mycoskie

start something that matters   blake mycoskie
... courtesy of the author Library of Congress Cataloging-in-Publication Data Mycoskie, Blake Start something that matters / Blake Mycoskie p cm eISBN: 978-0-679-60352-8 Marketing—Social aspects Social ... to start something that matters In addition to sharing the lessons learned, 50 percent of my proceeds from this book will be used to support inspired readers through the Start Something That Matters ... who is interested start something that matters In this book, I describe some of the counterintuitive principles that have helped TOMS grow from an interesting idea to a company that in five years...
  • 129
  • 930
  • 10

It is said that …. He is said ..(be) supposed to & Have something done

It is said that …. He is said ..(be) supposed to & Have something done
... Đôi it is supposed to … = it is said to Let’s go and see that film It s supposed to be very good ( =it is said to be very good) Hãy xem phim Nghe nói phim hay “Why was he arrested?” He s supposed ... supposed to have kicked a policeman.” (He is said to have kicked a policeman) “Tại anh bị bắt?” “Người ta nói anh đá người cảnh sát.” Nhưng supposed to có nghĩa khác Something is supposed to happen” ... ngày The police are looking for a missing boy (Cảnh sát tìm kiếm đứa bé tích) It is believed that the boy is wearing a white pullover and blue jeans Hay The boy is believed to be wearing a white...
  • 5
  • 282
  • 2

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... Periplasmic NirF binds d1 heme S Bali et al NirF were fractionated and run on the SDS ⁄ PAGE for western analysis by using the alkaline phosphatase conjugate of strep-tactin antibody, we found that ... from Saccharomyces cerevisiae), we found that the two proteins had 24% sequence similarity A crystal structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important ... substrate for NirF that is translocated In either case the transport process is enigmatic as none of the Nir proteins codes for a transmembrane protein that could be a candidate for moving d1 heme, ...
  • 12
  • 236
  • 0

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt
... these questions using a strategy of single amino acid site-directed mutagenesis Delineation of ExoS residues of the cofactor interaction domain within ExoS Various single mutant ExoS proteins ... study study study study study 639 Delineation of ExoS residues L Yasmin et al Fig Interaction of GST-ExoS variants with endogenous 14-3-3 proteins HeLa cells were harvested and lysates were subjected ... strategy for its interaction with 14-3-3 that is similar to that seen with R18 and serotonin N-acetyltransferase This is because R18 is also nonphosphorylated and serotonin N-acetyltransferase selectively...
  • 9
  • 288
  • 0

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
  • 12
  • 288
  • 0

FOREST AND PAPER INDUSTRY - A mature industry that has done much to clean up its act. pptx

FOREST AND PAPER INDUSTRY - A mature industry that has done much to clean up its act. pptx
... Substitution as avoidance: The issue of paper vs plastic” Paper bag vs plastic bag at grocery store Paper cup vs polystyrene cup In each case, the life-cycle analysis shows that the non -paper choice ... on account of paper that cannot be recycled, such as archives and libraries, and papers used in construction materials (eubusiness.com) Same data displayed graphically 20 Corrugated cardboard ... year Much of this waste is burned, only aggravating air pollution Instead, these remainders can easily and economically be turned into paper Scrap material such as the leftovers from the manufacturing...
  • 25
  • 118
  • 0

Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx

Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx
... SYSTEM THAT ANNOTATES ITS ANSWERS 63 In addition, Panorama extends the query language with three statements to manipulate and query the meta -database To add a new property view to the meta -database, ... detector, a, b2 )} V4 is represented with two meta-tuples: (E, x3 ∗, Virginia, ) ∈ store (E, radar detector, x3 ∗, ) ∈ availability PANORAMA: A DATABASE SYSTEM THAT ANNOTATES ITS ANSWERS 3.3 59 Manipulation ... particular, each x and each y must appear at least once among the zs PANORAMA: A DATABASE SYSTEM THAT ANNOTATES ITS ANSWERS D E D Q Q c A 57 Ec A Figure Meta-processing We refer to such views as conjunctive...
  • 23
  • 188
  • 0

Báo cáo khoa học: Assessment of telomere length and factors that contribute to its stability potx

Báo cáo khoa học: Assessment of telomere length and factors that contribute to its stability potx
... essential to telomere replication but their roles in telomere and telomere length homeostasis are unclear and need to be investigated further [79,80] Importance of telomeres and telomere length Telomeres ... balance between telomere replication and telomere length stability The rapid pace at which telomere biology has moved has provided fascinating insights to several factors that contribute to maintaining ... screening of samples is questionable Factors influencing telomere length Telomeres Telomeres consist of tandem repeats (of a hexameric sequence in humans), which are positioned at the extreme ends of...
  • 15
  • 164
  • 0

Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx

Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx
... on the 3Â-end processing step (not shown) The effect of peptides on the strand-transfer reaction When the effects of the various peptides on the strandtransfer step of the IN enzymatic reaction ... group of peptides is attributable to their effect on the turnover number of IN, and suggest a different mode of action from that of the rst group The third group of peptides, which included IN-4 and ... resembles that of INS [56] To convert some of these peptides into efcient antiHIV drugs, it is essential to elucidate their mode of action and their effects on the kinetic parameters of the 3Â-end...
  • 15
  • 204
  • 0

Báo cáo khoa học: Chinese hamster apurinic⁄apyrimidinic endonuclease (chAPE1) expressed in sf9 cells reveals that its endonuclease activity is regulated by phosphorylation docx

Báo cáo khoa học: Chinese hamster apurinic⁄apyrimidinic endonuclease (chAPE1) expressed in sf9 cells reveals that its endonuclease activity is regulated by phosphorylation docx
... exonuclease activity of chAPE1 in our study Results Overexpression of chAPE1 in the sf9 cell line and its purification The expression level of chAPE1 in insect cells infected by the recombinant baculovirus ... (serine, threonine, tyrosine) The protein contains 11 sulfur atoms (in methionine, cystine), and its molecular mass is 35.5 kDa The mole number of chAPE1 was calculated using mass divided by the ... show that phosphorylation regulates chAPE1 endonuclease activity in vitro and that chAPE1 expressed in sf9 cell has a different level of phosphorylation at different time points of expression In...
  • 9
  • 152
  • 0

Báo cáo khoa học: Aptamers toEscherichia colicore RNA polymerase that sense its interaction with rifampicin, r-subunit and GreB ppt

Báo cáo khoa học: Aptamers toEscherichia colicore RNA polymerase that sense its interaction with rifampicin, r-subunit and GreB ppt
... effect on RNAP–aptamer interactions The r70-subunit and GreB suppress the interaction of the core RNAP with aptamers The r70-subunit inhibited the binding of all the aptamers to the core polymerase ... to free core RNAP Second, DNA molecules that interacted with RNAP were incubated with core RNAP in the presence of excess Rif DNA molecules that were unable to bind RNAP in complex with Rif were ... ligands that bind RNAP and stabilize alternative structural states of the enzyme could open the way for a better understanding of the conformational flexibility of RNAP Aptamers are synthetic RNA...
  • 11
  • 106
  • 0

báo cáo hóa học:" Comparative study on the immunogenicity between an HLA-A24-restricted cytotoxic T-cell epitope derived from survivin and that from its splice variant survivin-2B in oral cancer patients" pot

báo cáo hóa học:
... Western blotting analysis of survivin protein in oral cancer cell lines Western blotting analysis of survivin protein in oral cancer cell lines Lysates from oral cancer cell lines or normal oral mucosal ... peptides derived from survivin and its splicing variant survivin- 2B were examined for HLA-A24-binding affinity and immunogenicity [22] It was shown that Survivin- 2B80-88 peptide (amino acid sequence ... splicing variants of human survivin have been described, including survivin- 2α, survivin- 2B, survivin- ΔEx3, and survivin- 3B [12-15] While survivin- and survivin- 3B are truncated forms, survivin2 B results...
  • 11
  • 152
  • 0

financial report 1999 holderbank the financial results posted in 1999 demonstrate that the group has further consolidated its position and created real added value

financial report 1999 holderbank the financial results posted in 1999 demonstrate that the group has further consolidated its position and created real added value
... from Financing Activities The equity capital paid -in and the increase of borrowings were related to the refinancing of existing financial liabilities and the financing of the Group s expansion and ... equipment selling price and value in use The net selling price is the Gains from a sale are included in the liability, and the fi- amount obtainable from the sale of an asset in an arm’s nancing costs ... about 2000 and expect a further increase in Group operating profit, provided the CHF remains roughly at its current level The past year has demonstrated that the Group is stronger and more flexible...
  • 74
  • 141
  • 0

Xem thêm