7560 are you a healthy eater (1)

7560 are you a healthy eater (1)

7560 are you a healthy eater (1)
... rice and pasta FATS make you strong and give you energy There are fats in meat, butter and cheese and oil VITAMINS are important for your eyes, your skin, your bones, your hair and for other parts ... because…………………………………” D Read about the foods we eat Do you eat all of the seven important things? Tell your partner CARBOHYDRATES give you energy There are carbohydrates in bread, sugar, potatoes, ... not a lot of it Here you can find diary product, chicken, fish, fruit And what about your answers? How much fruit you eat? The last group is green – GO You can eat how much you want Vegetables...
  • 3
  • 36
  • 0


... and change the situation around you instead of letting it change you When the hours are the darkest and trials are their greatest you elevate to another level? How you handle Adversity? ARE YOU ... you respond? Are you a carrot , an egg, or a coffee bean?" Think of this: Which am I? Am I the carrot that seems strong, but with pain and adversity, I wilt and become soft and lose ... hot water - the very circumstances that bring the pain When the water gets hot, it releases the fragrance and flavor of the bean If you are like the bean, when things are at their worst, you get...
  • 4
  • 235
  • 1

scientific american - 2003 08 - are you a hologram

scientific american   -  2003 08  -  are you a hologram
... Group +4 4-2 0 7-5 9 2-8 331 fax: +4 4-2 0 7-6 3 0-9 922 France and Switzerland PEM-PEMA +3 3-1 -4 6-3 7-2 117 fax: +3 3-1 -4 7-3 8-6 329 Germany Publicitas Germany GmbH +4 9-2 1 1-8 6 2-0 9 2-0 fax: +4 9-2 1 1-8 6 2-0 9 2-2 1 Sweden ... Database (www naturaldatabase.com), a pay site that explains what herbals are used for, what they are safe (or unsafe) for and how they interact with various drugs David M Jones via e-mail A ... Publicitas Nordic AB +4 6-8 -4 4 2-7 050 fax: +4 6-8 -4 4 2-7 059 Belgium Publicitas Media S .A +3 2-( 0) 2-6 3 9-8 420 fax: +3 2-( 0) 2-6 3 9-8 430 Middle East and India Peter Smith Media & Marketing +4 4-1 4 0-4 8 4-1 321 fax:...
  • 83
  • 340
  • 0

4955 are you a chocoholic

4955 are you a chocoholic
... pronouns (my, your, his, her, its, our, their): a Chocolate is wonderful! is favorite sweet Do you like ? b Lisa can’t eat chocolate because has allergy c What like with chocolate? d ... so selfish! Give a piece of your cake too e chocolate bar is made with strawberry and is delicious! 8) Vocabulary : Things made of chocolate Write the names : a b _ c e ... Grammar 5) Consider the sentence “Chocolate contains three drugs” a Change it into Negative form: _ b Change it into Interrogative form: _ 6) “The drug causes...
  • 2
  • 75
  • 0

3041 are you a fashion victim

3041 are you a fashion victim
... Answers 1) come into fashion, go out of fashion, a fashion victim, to be all the fashion/ rage, after a fashion 2) 1-c, 2-e, 3-d, 4- a, 5-b 3) Jasmine is American - … lives in a small town ... small town in California She spends a lot of money on clothes – pay $300 for a pair of jeans She is not married – Jasmine is a single 21-year-old woman; she is young, extremely beautiful, single ... old – Jasmine is a single 21-year-old … She follows fashion trends to the letter – wearing red and orange skirts, dresses, blouses, T-shirts, shoes, socks, purses, trainers was all the fashion...
  • 2
  • 30
  • 0

Google Adwords-Chapter 1:"Are You Prepared To Profit From Instant Web Traffic?"

Google Adwords-Chapter 1:
... www.GoogleAdwordsMadeEasy.com TABLE OF CONTENTS n Chapter "Are You Prepared To Profit From Instant Web Traffic?" .4 n Chapter "10 Minutes To Instant Web Traffic" 10 ... http://www.googleadwordsmadeeasy.com/Updates.htm www.GoogleAdwordsMadeEasy.com www.GoogleAdwordsMadeEasy.com Chapter "Are You Prepared To Profit From Instant Web Traffic?" Warning - If you' re not ... chance for you to convert that visitor into a customer) You pay a certain amount "per click" on your ad If nobody clicks on your ad, you don't pay a dime and also get no visitors The goal is to get...
  • 8
  • 173
  • 0

Tài liệu Tiếng Anh lớp 1, 2 - Lesson thirteen (Bài 13) AM I...? ARE YOU...? (Tớ là...? bạn là...?) New words (Từ pdf

Tài liệu Tiếng Anh lớp 1, 2 - Lesson thirteen (Bài 13) AM I...? ARE YOU...? (Tớ là...? bạn là...?) New words (Từ pdf
... thiết) - Am I a ? - , you are - Are you a ? - , I am not - Am I a ? - , you are not - Are you a ? - , I am - Am I a ? - , you are - Are you a ? - , I am not - Am ... sick? - No, I am not - Am I a pilot? - No, you are not - Are you a worker? - Yes, I am - Am I fit? - Yes, you are - Are you nice? - No, I am not - Am I a director? - No, you are not - Are you ... ? - , you are not - Are you a ? - , I am - Am I a ? - , you are - Are you a ? - , I am not Bước 4: Đọc câu sau dịch sang tiếng Việt: - Am I handsome? - Yes, you are - Are...
  • 6
  • 307
  • 3

Tài liệu Tiếng Anh lớp 1, 2 - Lesson eighteen (Bài 18) ARE WE...? ARE YOU...? ARE THEY...? pdf

Tài liệu Tiếng Anh lớp 1, 2 - Lesson eighteen (Bài 18) ARE WE...? ARE YOU...? ARE THEY...? pdf
... - Are we ? - , you are not - Are you ? - , we are - Are they ? - , they are not - Are we ? - , you are - Are you ? - , we are not - Are they ? - , they are ... are - Are they ? - , they are not - Are they ? - , they are - Are they ? - , they are not - Are they ? - , they are - Are they ? - , they are not - Are they ? - ... flowers? - No, they are not Are they trees? - Yes, they are Are they roses? - No, they are not Are they daisies? - Yes, they are Are they dogs? - No, they are not Are they cats? - Yes, they are Are...
  • 7
  • 243
  • 3

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 229
  • 0

Tài liệu Báo cáo khoa học: "Automatic Satire Detection: Are You Having a Laugh?" ppt

Tài liệu Báo cáo khoa học:
... and punctuation sequences (e.g a comma, or a closing quote mark followed by a period) are treated as separate features Method 3.1 Standard text classification approach 3.2 Targeted lexical features ... that informal language is much more common to satirical articles We measure the informality of an article as: def ∑ s(t) i = |T | t∈T Lexical approaches are clearly inadequate if we assume that ... Table The baseline is a naive classifier that assigns all instances to the positive where ¯ and σ are, respectively, the mean and stani dard deviation of i across all articles http://search.cpan.org/perldoc?...
  • 4
  • 187
  • 0

You Are Not a Gadget: A Manifesto (Vintage)

You Are Not a Gadget: A Manifesto (Vintage)
... department as Rapture images are in an evangelical bookstore (Just in case you are not familiar with the Rapture, it is a colorful belief in American evangelical culture about the Christian apocalypse ... Turks and Armenians, elders and kids, Israelis and Palestinians, rich professionals and struggling artists, formal academics and bohemian street musicians, all talking with one another about a shared ... until you find a computer that runs the hailstorm data as a program equivalent to your brain How you know when you ve found a match? There are endless options For mathematical reasons, you can never...
  • 129
  • 206
  • 0

''''The Worst Place in the World to be a Woman or Girl'''' – Rape in the DR Congo: Canada, Where Are You? docx

''''The Worst Place in the World to be a Woman or Girl'''' – Rape in the DR Congo: Canada, Where Are You? docx
... mineral-rich areas and to make the map accessible to the global public Canada, as the largest non-African investor in the DRC's mining industry and global leader in mineral exploration, has a ... political links Worst of all, the GoC is destroying its ability to effectively address mass rape in the worst place in the world to be a woman or a girl, a place from which Canada has a history ... SUMMARY 'THE WORST PLACE IN THE WORLD TO BE A WOMAN OR GIRL' The two eastern Kivu provinces of the Democratic Republic of the Congo (DRC) are the worst places in the world to be a woman or a girl...
  • 27
  • 185
  • 0

Slide tiếng anh 6 Unit 8 OUT AND ABOUT Lesson 1 What are you doing _Văn Vinh

Slide tiếng anh 6 Unit 8  OUT AND ABOUT Lesson 1 What are you doing _Văn Vinh
... Phương tiện tham gia giao thông Train Motorbike bike bus car Period 44 UNIT 8: OUT AND ABOUT Lesson 1: What are you doing? (A1,2,3) I NEW WORDS Play video games: Chơi điện tử Ride a bike : Đi xe ... Làm tập 1. 2 Chuẩn bị A: 4.5 .6 Học liệu tham khảo • Các tài liệu tham khảo chính: Sách giáo khoa Tiếng anh Sách giáo viên Tiếng anh Chuẩn khiến thức kỹ Tiếng anh Phầm mềm: Hsp-3000-en-05 060 1 Phầm ... Answer my questions What is he doing? He is playing video games Answer my questions What are they doing? They are playing soccer Answer my questions What is Ba doing? He is doing his homework...
  • 34
  • 150
  • 0

Brain Friendly Publiscations Who Are You Intermediate Questionnaires

Brain Friendly Publiscations Who Are You Intermediate Questionnaires
... that you re frightened to open your mouth Stand up for yourself and for others – it will earn you a lot more respect © Brain friendly Publications - www.brainfriendly.co.uk WHO ARE YOU? ARE YOU ... you had more time for others © Brain friendly Publications - www.brainfriendly.co.uk WHO ARE YOU? ARE YOU LOOKING AFTER YOUR HEALTH? ✍ points What does ageing mean to you? a there’s nothing you ... way you look really matter so much? 29–39 Your vanity assumes absurd proportions Are you a film star, by any chance? © Brain friendly Publications - www.brainfriendly.co.uk WHO ARE YOU? ARE YOU...
  • 25
  • 862
  • 2

Xem thêm