19230 order of statements

Tài liệu Báo cáo khoa học: "Order of Subject and Predicate in Scientific Russia" pptx

Tài liệu Báo cáo khoa học:
... Order of Subject and Predicate The clause contained no subject in 657 instances, or 22.55% of the total The predicate slot was filled by a verb in 1527 instances, or 52 40% of the total Of these ... was Subject Predicate in 1282 instances, 43.99% of the total; the word order was Predicate Subject in 245 instances, 8.41% of the total, the ratio being 1282/245, or approximately 5/1 The predicate ... the total Of these, the word order was Subject Predicate in 399 instances, 13.69% of the total; the word order was Predicate Subject in 97 instances, 33% of the total, the ratio being 399/97,...
  • 2
  • 223
  • 0

ORDER OF BUSINESS of the first part of the 2007 Ordinary Session (22-26 January 2007) adopted by the Assembly on 22 January 2007 doc

ORDER OF BUSINESS of the first part of the 2007 Ordinary Session (22-26 January 2007) adopted by the Assembly on 22 January 2007 doc
... e Examination of credentials (Doc 11124) Election of the President of the Assembly Election of the Vice-Presidents of the Assembly Appointment of members of committees (Commissions (2007) 1) Requests ... Monday 22 January 2007 a.m Bureau of the Assembly 9.30 a.m Political groups 11.30 a.m Opening of the first part of the 2007 Ordinary Session (oldest member in the Chair: Mr Miguel ... penalty by Council of Europe member states" Adoption of the order of business Adoption of the minutes of the meeting of the Standing Committee (17 November 2006, San Marino) f g Progress report of the...
  • 6
  • 226
  • 0

Báo cáo khoa học: Versatile regulation of multisite protein phosphorylation by the order of phosphate processing and protein–protein interactions pptx

Báo cáo khoa học: Versatile regulation of multisite protein phosphorylation by the order of phosphate processing and protein–protein interactions pptx
... thermodynamic aspects of complex multisite phosphorylation on the one hand, and the specific and versatile regulation of protein activation required in signaling pathways on the other Results Mathematical ... of the response curve is strongly affected by the two groups of parameters that determine the protein protein interactions: the concentrations of the enzymes relative to the target protein, and ... states and pathways of phosphorylation and dephosphorylation It will be an aim of this study to elucidate the consequences of processing order for the regulatory properties of the target protein...
  • 16
  • 195
  • 0

Báo cáo khoa học: "Order of Subject and Object in Scientific Russian When Other Differentia Are Lacking" ppt

Báo cáo khoa học:
... Table INSTANCES OF MORPHOLOGICALLY INDISTINGUISHABLE SUBJECT AND OBJECT IN A SAMPLE OF RUSSIAN PHYSICS TEXT * Three subjects are in apposition with conjunctions of Non-Cyrillic occurrences Subject ... resolved, situations in which a modifier of either noun distinguished its case were recognized and discarded, subject and object were differentiated by careful human judgment, and their order was ... found in 22, 000 occurrences.5 They are summarized in Table The subject precedes the verb 52 times; the object follows the verb 56 times When both object and subject follow the verb, the object...
  • 3
  • 168
  • 0

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
... restriction to Lck accessing certain tyrosine residues of the protein chain Our studies have determined the efficiency of phosphorylation of each of the six f ITAM tyrosines by PTK Lck, from which ... vitro phosphorylation by Lck, confirmed tyrosine 1N to be the first phosphorylated Differences arising in the order of phosphorylation of the subsequent tyrosines in the whole cTCRf chain in vitro, ... rate-limited by ATP concentration The levels of incorporation of 32P into the peptide were used to calculate the kinetics of phosphorylation by Lck at each tyrosine, and from these an order of phosphorylation...
  • 8
  • 313
  • 0

Báo cáo khoa học: "The order of prenominal adjectives in natural language generation" doc

Báo cáo khoa học:
... a number of statistical and machine learning techniques to the problem of predicting the order of prenominal adjectives in English The scores for each of the methods are summarized in table The ... clustering of English words In Proceedings of the 30th annual meeting of the Association for Computational Linguistics, pages 183–190 J Ross Quinlan 1986 Induction of decision trees Machine Learning, ... pi of finding each class i in the instance base D, we can compute the entropy H(D), a measure of the amount of uncertainty in D: H(D) = − ∑ pi log2 pi pi In the case of the adjective ordering...
  • 8
  • 199
  • 0


Báo cáo hóa học:
... technique for first order initial value problems, Applied Mathematics and Computation 87 (1997), no 2-3, 217–226 , Quasilinearization and rate of convergence for higher- order nonlinear periodic boundary[ 5] ... uniformly and monotonically to the unique solution of (3.1) and the convergence is of order Remark 3.3 Similar results can be obtained for the other two coupled upper and lower solutions of (3.1) ... Communications 141 (2001), no 2, 268– 281 [12] T Melton and A S Vatsala, Generalized quasilinearization and higher order of convergence for first order initial value problems, to appear in Dynamic Systems...
  • 15
  • 98
  • 0

The Order of Adjectives in a Series docx

The Order of Adjectives in a Series docx
... friendly fat young man man a 18th century a Scottish fantastic castle 10 a horrible greedy businessman fat friendly young our boring tall headmaster a business horrible greedy 11 a big old brown bear ... bear tall our headmaster boring a long dark wooden table a big old brown bear 12 a self-righteous middle-class student wooden dark a table long a beautiful old Spanish city city a Spanish beautiful ... old maths teacher a perfect new system my teacher old maths smelly a small old black Turkish box new a perfect system a fantastic 18th century Scottish castle black small box Turkish a old a friendly...
  • 2
  • 175
  • 0


Báo cáo toán học:
... 2t)-graphs of orders at least as large as the upper bound in (2) were constructed in [9] by F¨ redi, Seress, and the authors u The fact that the orders of these constructions actually meet the upper ... that these upper bounds are roughly the squares of the previously indicated lower bounds In this paper we establish general upper bounds on v(k, g) which are roughly the 3/2 power of the lower bounds, ... whose orders are at least as large as the upper bound in (2) were constructed by F¨ redi, Seress and the authors, u see [9] The fact that the orders of these constructions actually meet the upper...
  • 11
  • 175
  • 0


Báo cáo toán học:
... Handbook of Mathematical Functions, National Bureau of Standards, Washington DC, 1972 P Erd˝s and P Tur´n, On some problems of a statistical group theory, III,, Acta Math Acad o a Sci Hungar 18 (1967), ... since we may always take p = q) we may halve the distance from m to n by one application of this inequality After (n) (n) at most log2 n applications of the above inequality we obtain bm ≤ nbs ... and P Tur´n, On some problems of a statistical group theory, IV, Acta Math Acad o a Sci Hungar 19 (1968), 413–435 W Goh and E Schmutz, The expected order of a random permutation, Bull Lond Math...
  • 6
  • 180
  • 0

Báo cáo toán học: "The order of monochromatic subgraphs with a given minimum degree" doc

Báo cáo toán học:
... is a monochromatic subgraph with minimum degree at least d and order at least t If G has an r-coloring of its edges with no monochromatic subgraph of minimum degree at least d we define fG (d, r) ... S Also, add to P all other vertices of V (G) \ (X ∪ S) and all their incident edges Notice that the obtained subgraph is a k-subgraph of G that contains a vertex of X, a contradiction Now assume ... can use the recursion to show that this r/2-colored linear subgraph has a linear order subgraph which is monochromatic x is chosen so as to maximize the order of the final monochromatic subgraph...
  • 8
  • 179
  • 0

Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

Báo cáo y học:
... representation of a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the main layers of the placenta indicated (B) Higher magnification of the areas framed ... Structure and in situ hybridization forand eosin staining of a dayof day 12 rabbit placenta: (A) Schematic representation placenta bit placenta (right) and haematoxylin syncytin-Ory1 expression 12 placenta ... 50°C, at 68°C) The primers used were: 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the...
  • 11
  • 149
  • 0

Xem thêm