Comment on a activity vs relate experience

... We had a mobile phone We had a holiday We had a frisbee We had a karaoke machine She had a baby We had breakfast / lunch / dinner They are having a party (hosting an event) He is having a cigarette ... cigarette / a break (take) Have a bite / a drink / a seat (take) She is having a bath (take) Have a good day / holiday / Merry Christmas (enjoy) HAVING A PARTICULAR...

Ngày tải lên : 25/08/2016, 19:49

6
99
0

Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

... Activity 7.2: Determining the Impact of Technology on a Windows DNA Design Exercise 1: Determining Technology Implications ! Determine technology implications Participate in small groups as assigned ... Determining the Impact of Technology on a Windows DNA Design 51 Write your answers in the table below User Interface User Services Business...

Ngày tải lên : 21/12/2013, 06:16

4
631
0

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên : 18/02/2014, 11:20

15
635
0

Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx

... Function of SP isoform of type III AFP M Takamichi et al isoforms with respect to the TH value has been identiﬁed [6–8] For example, an AFGP based on a repetitive polypeptide consisting of Thr–Ala–Ala ... successive stacking of hexagonal ice plates on the basal plane, leading to the formation of an ice bipyramid, as illustrated in Fig When pyramidal planes are created...

Ngày tải lên : 16/03/2014, 04:20

9
289
0

Central Bank Interest-Rate Control in a Cashless, Arrow-Debreu economy: a comment on Wallace pptx

... Central Bank Interest-Rate Control in a Cashless, Arrow-Debreu economy: a comment on Wallace Colin Rogers School of Economics University of Adelaide colin.rogers@adelaide.edu.au Abstract: Wallace ... theory Contrary to Wallace, the Arrow-Debreu model is incapable of shedding any light on monetary economics Part III briefly outlines Wallace s analysis of the r...

Ngày tải lên : 22/03/2014, 17:20

21
217
0

2012 Search Marketing - SEO Edition - Research and Insights on Creating and Capitalizing on a Rich End-User Search Experience potx

... MarketingSherpa 2012 Search Marketing Benchmark Report – SEO Edition 2012 Search Marketing – SEO Edition Benchmark Report Research and Insights on Creating and Capitalizing on a Rich End -User ... NEW RESEARCH AND INSIGHTS ON CREATING AND CAPITALIZING ON A RICH END-USER SEARCH EXPERIENCE A rich end-user experience has b...

Ngày tải lên : 23/03/2014, 03:20

18
374
0

Báo cáo hóa học: " Comment on “on the stability of quadratic double centralizers and quadratic multipliers: a fixed point approach” [Bodaghi et al., j. inequal. appl. 2011, article id 957541 (2011)]" pot

... Comment on on the stability of quadratic double centralizers and quadratic multipliers: a fixed point approach” [Bodaghi et al., j inequal appl 2011, article id 957541 (2011)] Journal of Inequalities ... ∈ A , and a mapping R : A → A is a quadratic right centralizer if R is a quadratic homogeneous mapping and R(ab) = a2 R(b...

Ngày tải lên : 20/06/2014, 22:20

7
366
0

Báo cáo hóa học: "Biocompatible micro-sized cell culture chamber for the detection of nanoparticle-induced IL8 promoter activity on a small cell population" pot

... guarantee a statistical analysis of the generated data The MCC represents an array of miniaturized cell culture chambers for permanent noninvasive characterization of individual cells in a cell ... microplates, the new miniaturized cell culture chamber enables a fast and sensitive quantification of IL8 promoter activations that is based on the analysi...

Ngày tải lên : 21/06/2014, 00:20

14
632
0

Báo cáo y học: "Is fibromyalgia a cardiovascular disease? A comment on Martinez-Lavin’s review ‘Stress, the stress response system, and fibromyalgia’" ppsx

... References Martinez-Lavin M: Biology and therapy of fibromyalgia: Stress, the stress response system, and fibromyalgia Arthritis Res Ther 2007, 9:216 Fontenele JB, Félix FHC: Fibromyalgia and related ... medically unexplained symptoms: a lost link between cardiovascular and nociception modulation? J Musculoskeletal Pain, in press Stewart J, Taneja I, Medow MS: Reduce...

Ngày tải lên : 09/08/2014, 10:21

2
224
0

Báo cáo y học: "Off-pump or Minimized On-pump Coronary Surgery - Initial experience with Circulating Endothelial Cells (CEC) as a supersensitive marker of tissue damage" pptx

... +4 9-2 2 1-4 7832508 Fax: +4 9-2 2 1-4 7832509 eMail: Th.Wittwer-MD@t-online.de -2 - Abstract Background: Off-pump -coronary- artery-bypass-grafting (OPCAB) and minimized- extracorporeal-circulation (Mini-HLM) ... Coronary artery bypass grafting without cardiopulmonary bypass Ann Thorac Surg 1996; 61: 6 3-6 6 Feng ZZ, Shi J, Zhao XW, Xu ZF Meta-analysis of on-pump and of...

Ngày tải lên : 10/08/2014, 09:22

29
344
0

báo cáo khoa học: "Volcano-like intermittent bleeding activity for seven years from an arterio-enteric fistula on a kidney graft site after pancreas-kidney transplantation: a case report" pps

... Pascher A, Langrehr J, Jonas S, Kahl A, Frei U, Neuhaus P, Pratschke J: Complication rate of pancreas retransplantation after simultaneous pancreas -kidney transplantation compared with pancreas after ... arterioenteric fistula in a pancreatorenal transplant patient Ann Emerg Med 2003, 42:587-591 15 Semiz-Oysu A, Cwikiel W: Endovascular management of acute enteric bleeding from...

Ngày tải lên : 11/08/2014, 02:22

3
213
0

báo cáo khoa học: " Some historical remarks on the conservative treatment of facial paralysis – comment on ''''Temporary ectropion therapy by adhesive taping: a case study''''" pot

Ngày tải lên : 11/08/2014, 20:20

1
254
0

Báo cáo y học: " Withdrawal of inhaled corticosteroids in individuals with COPD - a systematic review and comment on trial methodology" ppt

... were only able to conduct one meta-analysis Meta-analysis There are reasons for being cautious about the one meta-analysis we conducted and, in general, meta-analysing results from these types of ... clearly for at least one trial As a result we only conducted a meta-analysis for one outcome: whether or not a patient had an exacerbation during the study period Meta-analysis indic...

Ngày tải lên : 12/08/2014, 13:22

10
394
0

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high sca...

Ngày tải lên : 23/11/2012, 15:04

51
393
0