5 forms of the verb 20 phrasal verbs communication

Choose the correct forms of the verb potx

Choose the correct forms of the verb potx
... living here for years are has has been have been - They _ on the project at the moment working be working is working are working - Do you still _ to the tennis club? belongs are belong belonging ... works - I to a great radio show on the way to work listening to listening have listening was listening - Tom's not here He's out _ his mother visit visited visiting is visiting - She ... see has see seen seeing - I _ football after work play to play playing am play 10 - We _ a lot of volunteer work are doing does ...
  • 4
  • 198
  • 0

Give correct forms of the verbs

Give correct forms of the verbs
... next week, he (see) the Eiffel Tower 46 I myself (witness) an accident on the Main Road yesterday A boy (knock) down by a car Then he (take) to the nearest hospital 47 Most of the Earth’s surface ... first as I (not get up) so early 66 Cuckoos (not build) nests They (use) the nests of other birds 67 I (wear) my sunglasses today because the sun is very strong 68 I wish that dog (lie down) He (keep) ... (feel) something hit me in the back I (not know) what it was 72 When I (see) the man, he (stand) outside the bank He (have)a cap on 73 When I (open) the cupboard door, a pile of books (fall) out 74...
  • 2
  • 332
  • 2

Tenses and forms of the verbs (very hot)

Tenses and forms of the verbs (very hot)
... 107 They will pass the exam if they (study)…………….hard 108.They said that they (will try)……………… their best to the test 109 .The kids (sleep)………………when the bell rang 110.She (eat)……………a lot of fruit ... 43- They had to cancel the flight because of the bad weather The flight 44- We must finish the project on time The project 45- People can find a cure for cancer in the ... arrived late for the concert Despite 10- It's a pity our teacher isn't here at the moment I wish 11- They'll have to change the date of the meeting again The date ...
  • 8
  • 259
  • 9

TOPIC 3 FORMS OF THE VERBS

TOPIC 3  FORMS OF THE VERBS
... them 33 We began (talk)…………………………… about next year’s holiday two months ago 34 I remember (lock)………… the door when I left but forgot (shut) ………… the window 35 He agrees (start)…………………………… the ... yet? 30 We decided (rent)……………………… a house with a swimming pool 31 Can you help me (get) …………………… the dinner ready? 32 When we arrived, the people next door invited us (have)……………a drink with them ... possible 36 I finished (read)………………………… the book and went to bed 37 My teachers always expected me (do)………………………………… well in exams 38 Let me (pay) ………………………………… for the meal You paid last time 39 I...
  • 3
  • 259
  • 3

Tài liệu MARKETING APPLE 5 SECRETS OF THE WORLD''''S BEST MARKETING MACHINE pptx

Tài liệu MARKETING APPLE 5 SECRETS OF THE WORLD''''S BEST MARKETING MACHINE pptx
... Well APPLE DOESN’T HAVE SOME special place where their marketing secrets are kept, unless of course you count their charismatic CEO’s brain The five secrets I offer here are careful ... engineers they are a pure Apple marketing trick designed to make the visible part of their product a status symbol Wear white This eBook courtesy of Steve Chazin, former Apple, Inc sales and marketing ... tricks you can apply to help your business Learn some of the marketing secrets that propelled Apple from the backwaters of the PC market to the worldwide leader in consumer electronics, music,...
  • 8
  • 282
  • 0

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot
... influence the protonation state of the carboxyl group of their side-chain [7] The aim of the present study was to express Gas1p at high levels for biochemical and structural characterization of the protein ... acid residues are essential for the two-step activity (Fig 6B,C) In addition, the sGas1482-H protein was analyzed for activity before and after removal of the N-linked chains by Endo H The complete ... wild-type Gas1p or the Gas1- C74S mutant were labelled for with [35S]methionine and the behaviour of the labelled forms was monitored at different time-points after the chase (Fig 7B) The ER form of Gas1p...
  • 11
  • 219
  • 0

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... band seen in NT2-N cells is present in brain, but not in PBL (Fig 3A, lanes and 3) To examine whether the CbD4 variants were expressed in different parts of the brain as well as in fetal brain, ... was carried out using the Cb common primer pair on cDNA from hippocampus, amygdala and cerebral cortex of human adult brain, and on cDNA from human fetal brain Cb was barely detectable in fetal...
  • 13
  • 165
  • 0

Xem thêm

Từ khóa: Quyết định 2134 QĐ-UBND bổ sung kế hoạch sử dụng đất năm 2016 thành phố Đà Lạt, tỉnh Lâm ĐồngQuyết định 2120 QĐ-UBND năm 2016 phê duyệt Đề án hỗ trợ người có công với cách mạng về nhà ở (đợt 2) trên địa bàn thành phố Hải PhòngQuyết định 3151 QĐ-UBND năm 2016 Quy định tạm thời áp dụng đơn giá tính thiệt hại do thiên tai gây ra trên địa bàn tỉnh Lào CaiQuyết định 23 2016 QĐ-UBND Quy định về đấu giá quyền khai thác khoáng sản thuộc thẩm quyền cấp phép của Ủy ban nhân dân tỉnh Ninh BìnhQuyết định 65 2016 QĐ-UBND Quy định chức năng, nhiệm vụ, quyền hạn và cơ cấu tổ chức của Trung tâm Xúc tiến Thương mại và Đầu tư tỉnh An GiangQuyết định 41 2016 QĐ-UBND Quy định chức năng, nhiệm vụ, quyền hạn và cơ cấu tổ chức của Sở Giao thông vận tỉnh Quảng TrịQuyết định 1257 QĐ-UBND năm 2016 phê duyệt báo cáo kinh tế - kỹ thuật công trình Sửa chữa, cải tạo đường xã Gia Trung, huyện Gia Viễn, tỉnh Ninh BìnhQuyết định 3397 QĐ-UBND năm 2016 phê duyệt Điều lệ tổ chức và hoạt động của Quỹ Bảo lãnh tín dụng doanh nghiệp nhỏ và vừa tỉnh Quảng NamQuyết định 29 2016 QĐ-UBND bãi bỏ văn bản quy phạm pháp luật do thành phố Cần Thơ ban hànhQuyết định 822 QĐ-SYT năm 2016 Quy chế quản lý hồ sơ công, viên chức và hợp đồng theo Nghị định 68 2000 NĐ-CP của Sở Y tế Hà GiangQuyết định 2958 QĐ-UBND năm 2016 về thành lập Văn phòng thường trực Ban Chỉ đạo vận động hiến máu tình nguyện thành phố Cần ThơQuyết định 2672 QĐ-UBND phê duyệt Danh sách hỗ trợ nhà ở đối với hộ nghèo theo Quyết định 33 2015 QĐ-TTg trên địa bàn tỉnh An Giang năm 2016 (Đợt 1)Quyết định 30 2016 QĐ-UBND Quy định thực hiện cơ chế một cửa, cơ chế một cửa liên thông tại cơ quan, đơn vị trên địa bàn tỉnh Bắc KạnQuyết định 2125 QĐ-UBND về phân bổ kinh phí hỗ trợ xi măng thực hiện Chương trình mục tiêu quốc gia xây dựng nông thôn mới năm 2016 do thành phố Hải Phòng ban hànhQuyết định 2264 QĐ-UBND năm 2016 điều chỉnh chế độ trợ cấp hàng tháng đối với thanh niên xung phong đã hoàn thành nhiệm vụ trong kháng chiến do tỉnh Thừa Thiên Huế ban hànhQuyết định 1266 QĐ-LĐTBXH năm 2016 công bố thủ tục hành chính thuộc phạm vi chức năng quản lý nhà nước của Bộ Lao động - Thương binh và Xã hộiQuyết định 3773 2016 QĐ-UBND về Quy chế hoạt động của Hội đồng Tư vấn đặt tên, đổi tên đường, phố và công trình công cộng trên địa bàn tỉnh Thanh HóaQuyết định 32 2016 QĐ-UBND quy định chức năng, nhiệm vụ, quyền hạn và cơ cấu tổ chức của Sở Tài chính tỉnh Vĩnh LongQuyết định 715 QĐ-UBND năm 2016 về ủy quyền thực hiện nhiệm vụ trong lĩnh vực bảo vệ môi trường thuộc thẩm quyền của Ủy ban nhân dân tỉnh Gia LaiQuyết định 2149 QĐ-UBND năm 2016 công bố thủ tục hành chính mới, sửa đổi thuộc thẩm quyền giải quyết của Sở Y tế tỉnh Nam Định