0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Parametric analysis of a circulating fluidized bed biomass gasifier for hydrogen production

báo cáo khoa học:

báo cáo khoa học: " Analysis of a post-translational steroid induction system for GIGANTEA in Arabidopsis" pdf

... 5'-GAATTAGGGAACAGCCACGA-3' for CO, 5'-CTGGAACAACCTTTGGCA AT-3' and 5'-TACACTGTTTGCCTGCCAAG-3' for FT, 5'-CGAAAGCTTCCTCCTGGTTA-3' and 5'-GAGTTTTGCCCCTCACCATA-3' for SOC1, 5'-GATTCCACGAGTTTGGGAGA-3' ... 5'-GATTCCACGAGTTTGGGAGA-3' and 5'-CCTTAGCCATTGGGAGATCA-3' for TOC1, 5'-GCGTTGCCTCCTAATGGTAA-3' and 5'ACCCTCCAACTCCCTGTACC-3' for HAP 3A, 5'TGCTTTTTCATCGACACTGC-3' and 5'-CCATATGTGTCCGCAAAATG-3' for At2g32170, ... with a dilution series of an arbitrary cDNA sample The following primer pairs were used for qRT-PCR; 5'TTGCAACTCCAAGTGCTACG-3' and 5'-GCTCGAAGGAGTTCCACAAG-3' for GI, 5'-ACTGGTGGTGGATCAAGAGG-3' and...
  • 13
  • 245
  • 0
Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System

Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System

... the biomass of the giant reed and maintain the wetland potential is proposed as shown in Fig 10 In this method, the above-ground part of the giant reeds that will remain the following year are ... rhizomes remaining for the next year Thereafter, the giant reeds grow with the rhizome extension, and the giant reed community in the wetland is regenerated - 152 - Journal of Water and Environment ... accumulation, and translocation properties of the giant reed And based on the property, we propose a management method of a water treatment system using the giant reed Fig - Appearances of the Giant Reed, ...
  • 12
  • 1,043
  • 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators ... considered the same parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy...
  • 14
  • 416
  • 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

... types of Darrieus rotors are mainly available, namely troop skein (Eggbeater) Darrieus rotor and H-Darrieus rotor H-Darrieus rotor was in the same patent of 1931[2] It has two to three airfoil shaped ... 0.265 at a TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% and that of computational Ct from experimental ... 23 (a) Variation of Ct with TSR, and (b) deviation of computational Ct from experimental Cp for H/D ratio 2.10 (a) (b) Figure 24 (a) Variation of Cp with TSR, and (b) deviation of computational...
  • 16
  • 364
  • 0
Parametric analysis of geothermal residential heating and cooling application

Parametric analysis of geothermal residential heating and cooling application

... reads the annual TRNSYS heating and cooling load profile so as to determine the values of the peak heating and cooling loads for each month of the year (see Table 2) and their durations Moreover, ... current study as part of parametric analysis Sizing software calculates borehole length considering the heating and cooling demands In the current study the values of these demands are very close ... undisturbed ground temperature Parametric analysis and results Sizing GSHP system by GLD and GLHEPRO software for the given building loads and operation range of the first loop of the heat pump, the boreholes’...
  • 14
  • 495
  • 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always conservative [5] (2) The power system is a multi- state system ... reliability theory are always conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the...
  • 4
  • 407
  • 0
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A ! N # 7 # ? ... # * # A % ) % #) +D % - ) # A # B - B - 4F +D % - ) +D A +D D %+D) 6 # # # 6 + ; * # ' B %8 A 4FF &) **+ +D #0 D # - +D +D % ) * * B - +D A +D +D * # # 7 6 < +D +D 6 I < ' %8 A ! 60 A 4FF :C)...
  • 85
  • 645
  • 5
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) ... of a small heat shock /a- crystallin protein (p26) in encysted embryos of the brine shrimp, Artemia franciscana Am Zool 39, 836–847 Liang, P & MacRae, T.H (1999) The synthesis of a small heat shock /a- crystallin...
  • 10
  • 495
  • 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I, Hughes D & Liljas A (2000) Structure ... Structure 1, 3 5–5 0 Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid- resistant mutants...
  • 15
  • 474
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBPA (A,< /b> C) ELISA Recombinant His-tagged FnBRB (A)< /b> and < /b> FnBRA (C) and < /b> their ... fnbB P1 fnbA fnbB spa Wild type spa::Kanr fnbA::Tetr fnbB::Ermr spa::Kanr fnbA::Tetr fnbB::Ermr P1 fnbA fnbB spa (pCU1 fnbA+) spa::Kanr fnbA::Tetr fnbB::Ermr (pCU1::fnbA+ Cmr) P1 fnbA fnbB spa...
  • 16
  • 560
  • 0
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

... compounds To get a deeper insight into such biotransformations in situ 1H -NMR analysis in 1H2O is a valuable analytical method, although the substrates themselves are often ÔinvisibleÕ Several metabolites ... characterization of the initial acetylene hydratase is inevitable In case of the other, more common enzymes, which are involved a genomic sequence analysis and a comparison to the genome of other strains ... by in situ 1H -NMR analysis (1H d: 3.06 p.p.m) in 1H2O Spectra indicated the additional presence of a small amount of 3-ketopropanoate (1H d: 3.48 p.p.m) and acetaldehyde (1H d: 1.17 p.p.m) during...
  • 6
  • 360
  • 0
Security Analysis of a Cryptographically-Enabled RFID Device ppt

Security Analysis of a Cryptographically-Enabled RFID Device ppt

... a fraction of a second With additional use of an FPGA, an attacker can feasibly simulate a target DST after merely intercepting multiple authentication transcripts at longer range To validate ... the standpoint of an attacker, active scanning has the advantage of permitting a chosen-challenge attack Hence this type of attack permits the use of precomputed Hellman tables as touched on above ... kit contained a reader and antenna, as well as a variety of non-DST RFID devices We were able to separately purchase small quantities of DST devices in two different form factors To explain our...
  • 15
  • 550
  • 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are...
  • 8
  • 465
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... Using Maximum Entropy Aided by a Dictionary In Proceedings of EMNLP, pages 91–99 K Uchimoto, C Nobata, A Yamada, S Sekine, and H Isahara 2002 Morphological Analysis of The Spontaneous Speech Corpus ... Extraction from Corpora and Its Part -of- Speech Estimation Using Distributional Analysis In Proceedings of COLING, pages 1119–1122 M Nagata 1999 A Part of Speech Estimation Method for Japanese...
  • 10
  • 398
  • 0
14 point web copy analysis of a winning site pptx

14 point web copy analysis of a winning site pptx

... 'Peel Away' Outrageously Profitable Websites, and Learn Their Inside Secrets You Can Use to Turn YOURS Into a Profit-Pushing Powerhouse That Rams Streams of Cash Into Your Bank Account TODAY!" ... the planet, experts like Jonathan Mizel, Marlon Sanders, Joe Vitale, Yanik Silver and others, as they take you on a guided tour of their most profitable web sites Each online pro painstakingly ... Increase Your Business? Just Fill In A Few Blanks And PRESTO You’ve Just Created A Powerful, Money-Making Sales Letter! Web Copy Secrets "'Peel Away' Outrageously Profitable Websites, and Learn...
  • 24
  • 418
  • 0

Xem thêm

Từ khóa: morphological analysis of a large spontaneous speechequity analysis of a project414 algebraic analysis of a logic circuit with nand and nor gates772 feedback analysis of a d latchmonte carlo analysis of a pressure sensospecialist s analysis of a series of dna samplesdesign and fe analysis of a 150 kw machinean analysis of a successful emergency telemedicine ventureanalysis of a uk portfolioparametric model of a golf clubanalysis of a case of chorea acanthocytosis with dysautonomia pdfanalysis of a dna microarray datasettraffic analysis of a proxy operationdesign and implementation of a computer based inventory control system for a pharmaceutical storeutilization of a high resolution digital imaging system for the objective and quantitative assessment of hyperpigmented spots on the faceBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật