0
  1. Trang chủ >
  2. Thể loại khác >
  3. Tài liệu khác >

SPECIAL SIGNALS USED BY VESSELS IN PORTS AND IN THE CANAL

AN INVESTIGATION INTO LINGUISTIC FEATURES OF MODALITY MARKERS USED BY TEACHERS IN LECTURES IN ENGLISH

AN INVESTIGATION INTO LINGUISTIC FEATURES OF MODALITY MARKERS USED BY TEACHERS IN LECTURES IN ENGLISH

... a study into the linguistic features of webcomments on American Idol by American and Vietnamese in order to discover some typical linguistic features and then find out the similarities and differences ... study Linguistic Innovations and Interactional Features of Casual Online Communication in Japanese” by Yukiko Nishimura [27] explores the linguistic and interactional properties of informal asynchronous ... Encyclopedic, “commenting is the act of expressing an opinion or reaction in speech or writing” Giving comment to contestants’ performance is, therefore, defined as the act of giving an opinion or reaction...
  • 116
  • 508
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... (C), in the presence of 100 lM MPP+ (D), in the presence of 200 lM MPP+ (E), in the presence of 100 lM MPTP and 50 lM dopamine (F), in the presence of 200 lM MPTP and 50 lM dopamine (G), in the presence ... shows the kinetics of aggregation of a-synuclein in the presence of 100 lm MPTP and the effect of 50 lm dopamine on the aggregation process Dopamine delayed the lag phase of aggregation marginally ... solid line), in the presence of 100 lM neurotoxin ( , dotted line), in the presence of 200 lM neurotoxin ( , dotted line) and in the presence of neurotoxin and 50 lM dopamine (h, dashed line) • 1692...
  • 11
  • 754
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

... A. M study design, data analyses, manuscript preparation; SCB data analyses and manuscript review, and MBR performing experiments; JC Luminex data analysis and interpretation PK and HSJ data interpretation; ... control antibody, MEDI-507, at the same time of the administration of the anti -RSV antibody had no effect on the cytokine profile or other clinical and inflammatory parameters evaluated, therefore ... explore the relative importance and role that different cytokines and chemokines play in acute RSV disease severity Instead of targeting individual cytokines as potential therapeutic targets,...
  • 5
  • 357
  • 0
báo cáo hóa học:

báo cáo hóa học: " Methods to recognize work-related cancer in workplaces, the general population, and by experts in the clinic, a Norwegian experience" pptx

... article as: Langård and Lee: Methods to recognize work-related cancer in workplaces, the general population, and by experts in the clinic, a Norwegian experience Journal of Occupational Medicine and ... up to the labor inspectorate, the insurance scheme and/ or specialists in occupational medicine, to clarify the work-relatedness of the cancer case or disease and to determine to what extent the ... exposure and the disease justifies acceptance as occupational disease /cancer, in accord with current legislation As of today about 300 cases of cancer are reported yearly to the labor inspectorate in...
  • 10
  • 390
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx

... A. M study design, data analyses, manuscript preparation; SCB data analyses and manuscript review, and MBR performing experiments; JC Luminex data analysis and interpretation PK and HSJ data interpretation; ... control antibody, MEDI-507, at the same time of the administration of the anti -RSV antibody had no effect on the cytokine profile or other clinical and inflammatory parameters evaluated, therefore ... explore the relative importance and role that different cytokines and chemokines play in acute RSV disease severity Instead of targeting individual cytokines as potential therapeutic targets,...
  • 5
  • 562
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Steroid hormone receptors ERα and PR characterised by immunohistochemistry in the mare adrenal gland" ppt

... in uterine tissue A and B: ERα in mare 526 (intact in oestrus); C and D: ERα in mare 478 (intact in metoestrus); E and F: PR in mare 526 (intact in oestrus); G and H: PR in mare 478 (intact in ... of ERα staining was, in general, found in the glandular epithelium and the myometrium For intact mares, the mare in oestrus (mare 526) showed the strongest staining intensity and the highest proportion ... and PR in adrenal tissue Immunostaining for ERα and PR in adrenal tissue A and B: ERα in mare 744 (OVX); C and D: ERα in mare 502 (intact in dioestrus); E and F: PR in mare 744 (OVX); G and H: negative...
  • 9
  • 257
  • 0
Báo cáo y học:

Báo cáo y học: "Placenta Percreta-Induced Uterine Rupture Diagnosed By Laparoscopy in the First Trimester"

... early as weeks of gestation [6] In most cases of uterine ruptures that occur during delivery, the affected site is the lower uterine segment; however, in cases of uterine rupture during the first ... during the first trimester In addition, we recommend laparoscopy for the investigation of acute abdomen with unclear diagnosis in the first trimester of pregnancy Table The summary of uterine ruptures ... trimester, the site commonly affected is the fundus, as noted in our patient [7] The uterine ruptures in the first trimester were summarized in Table [3, 6, 8-11] The most common risk factor for uterine...
  • 4
  • 503
  • 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

... Identification of < /b> chromatin binding < /b> regions of < /b> LBR To analyze the < /b> binding < /b> of < /b> LBR to chromatin, we used the < /b> N-terminal portion of < /b> LBR, because this portion is responsible for the < /b> binding < /b> to chromatin [5,6] ... chromatin is stimulated by phosphorylation in the < /b> RS region of < /b> LBR by a kinase(s) in a synthetic phase egg cytosol (Fig 6) In interphase somatic cell nuclei, the < /b> binding < /b> of < /b> LBR to lamin < /b> B may be ... cytosol, which stimulated the < /b> binding < /b> to chromatin Suppression of < /b> the < /b> binding < /b> of < /b> LBR to chromatin by phosphorylation with a kinase(s) in a mitotic phase egg cytosol Fig Stimulation of < /b> the < /b> binding...
  • 11
  • 563
  • 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

... mutations that are located in the 23S rRNA processing stem (Fig 1) This structural region is subject to cleavage by RNase III and other ribonucleases during 23S rRNA maturation [16 ] In particular, ... sensitivity of mutant IF1 As we had established that processing defects in 23S rRNA act as suppressors of a cold-sensitive IF1 mutant, we reasoned that other similar defects in 50S maturation as a whole ... CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed in...
  • 12
  • 439
  • 0
Báo cáo khoa học: Role of peroxidase inhibition by insulin in the bovine thyroid cell proliferation mechanism pdf

Báo cáo khoa học: Role of peroxidase inhibition by insulin in the bovine thyroid cell proliferation mechanism pdf

... responsible for the decrease of thyroid hormone biosynthesis in primary cultures in the presence of insulin In addition, our data suggest that insulin stimulates cell division, in bovine thyroid cultures, ... significant increase in concentration of the peroxidase inhibitor by the action of insulin, during 48 h, in thyroid primary cultures with 0.1% fetal bovine serum, totally depleted of the hormone, 48 ... results, without discarding the anti-apoptotic effect of insulin [24], demonstrate that both insulin and the peroxidase inhibitor, in the absence of TSH, stimulate cell growth of thyroid cultures Conversely,...
  • 8
  • 440
  • 0
Summary of Ph.D thesis: A study on the embankment caculation method reinforced by geotextile in the construction of highway in Vet Nam

Summary of Ph.D thesis: A study on the embankment caculation method reinforced by geotextile in the construction of highway in Vet Nam

... certain materials For the first time in Vietnam , the filtering function , drainage was used in the retaining wall of the path to the bridge on National Road , Tan Thinh , Hanoi - Lang Son Geotextile ... enhance the load capacity and stability of the construction work in general and especially the ground up for work in the construction of roads and irrigation In the 80s of the last century geotextile ... systems in urban areas Trung Hoa - Nhan Chinh (Hanoi) , before spreading the layer of macadam people to spread a layer of geotextile Specifications for separating the sand embankment that separates...
  • 31
  • 563
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Cambioxylophagous fauna of young spruce stands damaged by snow in the Beskids" potx

... colonization by cambiophages in July The degree of wilting at the end of the growing season eliminates a possibility of the repeated attack of lying breaks by the spring generation of P chalcographus ... amitinus in stands 537 F3 and 545 D3 is of interest Assessing the cambioxylophages according to the level of the break-off cover the occurrence of species of the genus Dryocoetes in FTG 5H and of ... gradual At the end of the growing season, 66% of phloem remained live or in the first stage of wilting There is available wood for the invasion of secondary cambiophages in the following growing season...
  • 11
  • 430
  • 0
Báo cáo y học:

Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps

... article as: Yen et al.: Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats ... adenylate cyclase; ADM: adrenomedullin; ADMR: adrenomedullin receptor; GC: guanylate cyclase; Gs: stimulatory GTP-binding protein; nNOS: neuronal nitric oxide synthase; PKA: protein kinase A; PKG: protein ... Chan JYH: Nitric oxide regulates c-fos expression in nucleus tractus solitarii induced by baroreceptor activation via cGMP-dependent protein kinase and cAMP response elementbinding protein phosphorylation...
  • 9
  • 633
  • 0
Báo cáo y học:

Báo cáo y học: "PPARα downregulates airway inflammation induced by lipopolysaccharide in the mouse" ppt

... chemokine expression by lipopolysaccharide in vitro and in vivo J Immunol 1999, 163:1537-1544 Goodman RB, Pugin J, Lee JS, Matthay MA: Cytokine-mediated inflammation in acute lung injury Cytokine ... released by macrophages or airway epithelial cells upon activation plays an important role in neutrophilic inflammation induced by LPS [4] Indeed, TNF-α triggers the release of CXC chemokines, such ... during acute lung injury or COPD [1,6] In mice, airway inflammation induced by LPS is associated with an increase of the matrix metalloproteinases (MMP), MMP-2 and MMP-9 [7,8] MMP are a family...
  • 10
  • 321
  • 0

Xem thêm

Từ khóa: space used by tables in sql server 2008skin disease caused by changes in the immune system and infectionwars when it might have been quiet and safe by following in the peaceful ways of numasaints both under the law and before it were justified by faith in the mystery of christ s incarnationwork in pair work out what feature s the types of the mass media have in common and what main feature s each of them has by filling in the gaps with each type of mass media1 subject to regulation 4 these regulations apply to the following persons acting in the course of business carried on by them in the united kingdom relevant persons — chapter 2 provides an overview of developments in the regulation of financial reporting by smes in the uk since the 1980sclosing up the water circuits by use of evaporation and burning the concentratesgrouped by size in the key economic region of centraloverlaying two existing maps by dragging in the object managerports and protocols used by microsoft sql server 2008ports and protocols used by microsoft sql server 2008 r2has attracted increasing attention as a component of amperometriclglutamate sensors used in the food industry and clinical biochemistry the precursor of lgoxdna methylation affects important developmental processes in both plants and animals the process of methylation of cytosines at c5 is catalysed by dna methyltransferases mtasesports used by sql management studioBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam