HALF A SECOND BEFORE TSUNAMI
Tài liệu Báo cáo khoa học: A second independent resistance mechanism to Bacillus sphaericus binary toxin targets its a-glucosidase receptor in Culex quinquefasciatus docx
... CGCCAGGGAGCTCACATGCCGTT), and three 3¢ oligonucleotides (primer 3, GAAAAGCTTCAGCTGGAA GTTGAACGGCAT; primer 4, AACAAGCTTCACGAA ATCTCCCAGGTCCAC; primer 7, AACAAGCTTGA AATCTCCCAGGTCCACGGT) were used To facilitate cloning ... C quinquefasciatus laboratory colony Results Identification of proteins in larvae BBMF that bind specifically to Bin toxin As an initial approach to identify the molecular basis for the resistance ... indicate, at least in certain cases, the important role of glycolipids as receptors for the crystal toxin [45–47] For the interaction of the B sphaericus Bin toxin to its a- glucosidase receptor, ...
- 13
- 499
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
... 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI ... 93 3A 94 4A Satomura T, Kawakami R, Sakuraba H & Ohshima T (2002) Dye-linked d-proline dehydrogenase from hyperthermophilic archaeon Pyrobaculum islandicum is a novel FAD-dependent amino acid dehydrogenase ... kDa), catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa) and ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences The...
- 11
- 549
- 0
Tài liệu GLOBAL EMPLOYMENT TRENDS 2013 Recovering from a second jobs dip docx
... Hungary Hungary Ireland Latvia Austria Malta Malta Estonia Bulgaria Slovakia Romania Cyprus Slovenia Luxembourg Germany Belgium Italy Austria Slovakia Czech Rep Greece Portugal Croatia Lithuania ... Economies and European Union Central and SouthEastern Europe (non-EU) and CIS East Asia South-East Asia and the Pacific South Asia Latin America and the Caribbean Middle East North Africa SubSaharan Africa ... America and the Caribbean: Juan Chacaltana and Andrés Marinakis East Asia: Phu Huynh South-East Asia and the Pacific: Kee Beom Kim South Asia: Sher Verick Middle East: Ekkehard Ernst and Tariq Haq...
- 172
- 272
- 0
Tài liệu English as a Second Language Standards docx
... ESL Standards for Pre-K-12 Students (Alexandria, VA: Teachers of English to Speakers of Other Languages Inc., 1997) ENGLISH AS A SECOND LANGUAGE STANDARDS ENGLISH AS A SECOND LANGUAGE STANDARDS ... for academic purposes in all content areas ENGLISH AS A SECOND LANGUAGE STANDARDS 15 16 ENGLISH AS A SECOND LANGUAGE STANDARDS PRIMARY STUDENTS WHO ARRIVE IN PRIMARY SCHOOL HAVE A wide variety ... 0-7726-4550-7 English language Study and teaching as a second language - British Columbia English language Study and teaching as a second language Standards - British Columbia I British Columbia Ministry...
- 62
- 727
- 1
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
... in a language other than English 11 Supporting Children Learning English as a Second Language in the Early Years (birth to six years) Learning English as a second or an additional language Babies ... English as a Second Language in the Early Years (birth to six years) Language delay Research has shown that most children have no trouble learning English as a second language while maintaining ... 1990) to maintain the first or home language Supporting Children Learning English as a Second Language in the Early Years (birth to six years) The importance of language for young children The early...
- 31
- 1,043
- 2
Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx
... disambiguation methods In Proceedings of the International Conference on Theoretical and Methodological Issues in Machine Translation, pages 101–112 Rada Mihalcea and Dan I Moldovan 1999 An automatic ... topic signatures from Japanese text In particular cases, where one only cares about translation ambiguity, this technique can work on any language pair Conclusion and Future Work We presented a novel ... People’s Daily, one of the most influential newspaper in mainland China It maintains a vast database of news stories, available to search by the public Among other reasons, we chose this website because...
- 6
- 471
- 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp ... weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland Almost no expression was observed in fetal lung and heart, uterus, bladder, kidney, duodenum, trachea, ... Characterization of the human ST6Gal II (Eur J Biochem 270) 953 Fig Nucleotide and predicted amino acid sequence (A) and hydropathy profile (B) of human ST6Gal II, and (C) comparison of the sialylmotifs...
- 12
- 584
- 0
Báo cáo khoa học: "Exploiting Named Entity Taggers in a Second Language" ppt
... CoNLL-2002, pages 175–178 Taipei, Taiwan Ian H Witten and Eibe Frank 1999 Data Mining, Practical Machine Learning Tools and Techniques with Java Implementations The Morgan Kaufmann Series in Data Management ... September Xavier Carreras and Llu´s Padr´ 2002 A flexible disı o tributed architecture for natural language analyzers In Proceedings of LREC’02, Las Palmas de Gran Canaria, Spain Xavier Carreras, Llu´s ... algorithm that learns what’s in a name Machine Learning, Special Issue on Natural Language Learning, 34(1–3):211–231, February Andrew Borthwick 1999 A Maximum Entropy Approach to Named Entity Recognition...
- 6
- 396
- 0
English As a Second Language and English Literacy Development: A Resource Guide pdf
... exhibit a variety of responses and behaviours as they learn a new language and adjust to a new social environment Initially, some Kindergarten children who are learning English as a second language ... grade-appropriate – understand grade-appropriate text, with assistance text that may be unfamiliar and unsupported by visual – select main ideas in short pascontext clues, and that may sages from a variety ... stages of proficiency in their use of standard Canadian English Stage 1: Beginning to Use Standard Canadian English Appropriately Students at Stage can read and comprehend simple written Canadian...
- 126
- 519
- 0
A kiss before dying
... tii:gg Iisisi=EttE R j 1q) R a\ a a a. a : +a^ ) a 'T-t tr-i -Y h Q R ,a) (t) R b q) F - i Lrl a ifu** gs A siii3iiit I sEI s titit t$ -r € a R ts R s $ rn Fir bo* a. i c - E a UI R q bo q) v f r'l f ... * F = ^ d b ^ F H d F A - r b ( ) H F a F F -1-.t a q) F F : L r?1 / ( - A * c Hd +J i f f i ! v a dic ! R E a - ) r- J t : Q F , t "ir P A ' a t{ {-J U v) +1 r V a. : A i d ) (t) 0J lr v z ... q O - L) V k lv s (' a t - c.rt t q \ A l > / rAa v J A a d l L , 0.) ) , E : v A Y < H - F qJ v fi al frl ^U) F H - =' r H Q J ' - v l l' o U) J l oa = E E-\r tr (' a) -\ J q ) C t d r L...
- 45
- 444
- 0
leonardo da vinci a man before his time 1194
... a certain weigh After all Leonardo' s inventions was a success Leonardo Da Vinci was a man who exemplified the best qualities of a 15th century man In addition, he had a practical understanding ... ideas, inventions, remain today Furthermore Leonardo' s achievements had no limits Similarly he had a huge impact on mankind Furthermore, he was a man with good qualities As a result, Leonardo Da ... well Leonardo Da Vinci had a huge impact on mankind Therefore, if it was not for Da Vinci' s sketches, incredible brainstorms and marvelous efforts; today we would not be at this level of modern and...
- 2
- 495
- 0
Báo cáo " Student writing process, perceptions, problems, and strategies in writing academic essays in a second language: A case study " docx
... library, reading too much and forgetting what was read, and not remembering where the ideas came from He then spent a lot of time reading the books again and again Hai also revealed in the informal ... Journal of Science, Foreign Languages 24 (2008) 184-197 database, and a chain of evidence (Yin [25]) and adopting a systematic and comprehensive data analysis scheme has helped increase the reliability ... real academic essay in real conditions of Vietnamese ESL students studying at an Australian university Its findings are firstly useful for us as teachers of English majoring in teaching writing...
- 14
- 585
- 0
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx
... Drosophila melanogaster A Fig Interaction of Drosophila melanogaster proliferating cell nuclear antigen (DmPCNA2) and DmPCNA1 (A) In vitro interaction of DmPCNA2 and DmPCNA1 Lanes 1–5: the indicated ... of Drosophila melanogaster proliferating cell nuclear antigen (DmPCNA2) and DmPCNA1 in response to DNA-damaging agents (A) Immunofluorescent analysis of the localization of V5-tagged DmPCNA2 and ... for translation initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putative poly (A) addition signal sequence, 5¢-AATAAA [17,18] It encoded a predicted product of 255 amino acids with a molecular mass of...
- 12
- 404
- 0
Báo cáo khoa học: Saccharomyces cerevisiae a1,6-mannosyltransferase has a catalytic potential to transfer a second mannose molecule ppt
... contaminants may have a catalytic activity only toward the substrate (Man10GlcNAc2PA), where the first mannose was added to Man9GlcNAc2-PA, we purified Man10GlcNAc2-PA and used it as an acceptor, ... 17921–17931 Nakayama K, Nakanishi-Shindo Y, Tanaka A, HagaToda Y & Jigami Y (1997) Substrate specificity of alpha-1,6-mannosyltransferase that initiates N-linked mannose outer chain elongation in Saccharomyces ... (5¢-TTCAAAAGC ATAGTATCCATAGCTGAGTAAATACCACCTCTTG-3¢), and the pPICZaA-ScOCH1 as a template The both D18 8A mutant and wild-type proteins were expressed as mentioned above After the culture supernatants...
- 12
- 251
- 0
HALF A SECOND BEFORE TSUNAMI
... This picture was taken on the banks of Sumatra Island (the height of waves was of approx 32 m = 105 ft) It was found saved in a digital camera, after the disaster We cannot know for sure, ... likely the one who took the picture is not alive any more (it was just a matter of seconds) Today we can see the last image he/she saw before ending life on Earth ...
- 2
- 164
- 0
Từ khóa: how to install a second operating system windows 7experience learning a second languagemy experience of learning english as a second languagetips for studying a second languagetips on learning a second languagelearning a second language experiencelearning english as a second language experiencemy experience learning a second languagetrace of a second rank tensortrace of a second order tensorhow to install a second operating system on my computerexperience with literacy in the primary language influence learning a second languagemethods of teaching english as a second languagetips on learning english as a second languagehow to install windows 7 as a second operating system on macNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP