Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target
Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx
... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during...
Hepatocellular Carcinoma – Clinical Research Edited by Wan-Yee Lau pptx
... orders@intechweb.org Hepatocellular Carcinoma – Clinical Research, Edited by Wan-Yee Lau p cm ISBN 978-953-51-0112-3 Contents Preface IX Part Diagnosis / Differential Diagnosis Chapter Hepatocellular Carcinoma: ... Hepatocellular Carcinoma – Clinical Research Edited by Wan-Yee Lau Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright...
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... implies that MYP has a role as a zinc transporter for gametogenesis In vertebrates, vitellogenin, a precursor of yolk protein, is a zinc- bind4994 ing protein that transports the zinc required for oogenesis ... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was...
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
... indicates that the location of HIP/PAP and RIIa is consistent with the relevance of their interaction HIP/PAP has been classified in the group of C-type lectins because it binds lactose and contains ... reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a protein of the endoplasmic reticulum lumen [23], HI...
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... 6C) The simulation results, based on experimentally determined parameters and a kinetic model of the 2393 The glyoxalase pathway in Leishma...
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire is diverse and the optimal antigen target ... Cite this article as: d’Hennezel et al.: IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in org...
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... non-Hodgkin’s lymphoma as a single agent as well as in combination therapy, emphasizing its high B-cell-depleting potency [8] In patients with lymphoma, rituximab infusion is frequently associated ... by the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myastheni...
Báo cáo y học: "Regulation of the JNK pathway by TGF-beta activated kinase 1 in rheumatoid arthritis synoviocytes" pps
... GS: Regulation of c-Jun N-terminal kinase by MEKK-2 and mitogen -activated protein kinase kinase kinases in rheumatoid arthritis J Immunol 2004, 17 2 :16 12 -16 18 Huang Q, Yang J, Lin Y, Walker C, Cheng ... purposes) Arthritis Research & Therapy 10 11 12 13 14 15 16 17 18 19 20 21 Vol No Hammaker et al Mor A, Abramson SB, Pillinger MH: The fibroblast-like syno...
Báo cáo y học: "RNA interference against polo-like kinase-1 in advanced non-small cell lung cancers" doc
... strand, while the silencing activity of the siRNA was maintained [18] Polo-like kinase-1 (PLK-1) belongs to the family of serine/threonine kinases and regulates cell division in the mitotic phase ... the systemic siRNA delivery with atelocollagen existed intact for at least days in tumor tissues using a mouse model [62] Preclinical application of RNAi therapy against PLK-1 in a...
Báo cáo y học: "Targeting insulin-like growth factor axis in hepatocellular carcinoma" ppsx
... insulin-like growth factor 2; IGF-1R: insulin-like growth factor receptor; IGF-2R: insulin-like growth factor receptor; IRS: insulin receptor substrate; IGFBPs: insulin like growth factor binding proteins; ... expression of insulin-like growth factor binding proteins in human hepatocellular carcinoma Mol Cell Biochem 2000, 207:101-104 82 Teishima J: Decreased e...
The roles of histone deacetylases 1 and 2 in hepatocellular carcinoma
... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy .....
Targeting polo like kinase 1 in glioma propagating cells
... of glioma 1. 4 Re-defining assay criteria for detecting GPCs 10 1. 5 PLK1 regulation and physiological role 11 1. 5 .1 PLK1 regulation 11 1. 5.2 Physiological role of PLK1 13 1. 5.3 PLK1 and tumors 15 ... 1. 9 34 3.3 PLK1 mRNA expression is elevated in glioma tumors PLK1 over-expression is common in several cancers of the breast 116 , ovaries 117 , prostate 118 and skin...
Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target
... (Polo- like kinase of X laevis); Snk (serum-inducible kinase) ; Fnk (fibroblastgrowth-factor-indiucible kinase) ; Prk (proliferation-related kinase) ; Sak (Snk akin kinase) xvi Table II: Polo- like kinase ... hours after transfection Caspase-3 activity assay was carried out (Fig 8) and intrigued to find that caspase-3 activation in si-PLK1 transfected Huh-7 was absent in th...
Từ khóa:
- angiogenesis signaling axis and hif 1 in hepatocellular carcinoma
- metallothionein mt was first identified in 1957 by m margosch and b vallee as a cadmium protein from equine kidney cortex in fact
- 11β hydroxysteroid dehydrogenase type 1 as a therapeutic target for type 2 diabetes
- monocytes macrophages in hepatocellular carcinoma
- interaction of tumour with host stroma in hepatocellular carcinoma
- signaling pathways and rationale for molecular therapies in hepatocellular carcinoma
- identification of cancer stem cell related micrornas in hepatocellular carcinoma
- k noguchi t naguro i ichijo h 2008 apoptosis signal regulating kinase 1 in stress and immune response annu rev pharmacol toxicol 48 199 225
- 60ni 22cr 9mo 3 5cb annealed grade 1 in welded tube plate sheet and strip section i
- unexplained visceral pain in children pathophysiology clinical features and management
- dyspepsia in children epidemiology clinical presentation and causes
- role of the host inflammatory response in colon carcinoma initiation progression and liver metastasis
- clinical biological and laboratory parameters as predictors of severity of clinical outcome and response to anti tnf alpha treatment in ulcerative colitis
- to like ex 1 look at the pictures ask and answer what these people like
- h et al 2012 quot aspirin resistance clinical significance and genetic polymorphism quot j int med res 40 1 pp 282 292
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Phát hiện xâm nhập dựa trên thuật toán k means
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Chuong 2 nhận dạng rui ro
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật