Inhibition of misfolded n cor induced survival pathway in APL by artemisinin
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"
... comparable study of visually-induced motion sickness We were especially interested in replicating and extending research by Drummond and Granston that showed that visually-induced motion sickness in ... herein extends this line of research by combining a visual motion sickness- inducing stimulus with pain and pre-treatment with rizatriptan In this study, rizatriptan does not appear to reduce visually-induced ... groups Motion sickness was not different between those subjects with a history of visually-induced motion sickness vs those subjects without a history of visually-induced motion sickness using the...
- 6
- 504
- 0
Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc
... serine and glycine was reduced from 33% in the light to 25% in the dark (Fig 7A) Glutamine and asparagine were the major amino acids in the xylem sap in both the light (63% of the total amino acids) ... 3195 Amino acid metabolism and translocation M.-H Valadier et al Table Amino acid composition in leaves, and amino acid percentage ratio in the phloem exudates and leaves and xylem bleeding sap and ... molecular signalling in the expression of the genes and encoded enzymes involved in nitrate assimilation and amino acid synthesis [7] The stalk and leaves below and above the ear act as the source...
- 14
- 566
- 0
Tài liệu Báo cáo Y học: Short peptides are not reliable models of thermodynamic and kinetic properties of the N-terminal metal binding site in serum albumin doc
... histidines (His67 and His247, presumably providing metal binding at site II and the neighbouring His242) bind phosphate ions, thereby providing another level of competition for metal ion binding Kinetics ... modelling of Cu(II) and Ni(II) transport by albumins On the other hand, the direct thermodynamic and kinetic characterization of Ni(II) binding at site I in HSA and BSA was obtained These data ... distinctly weaker than the model peptides A very strong inuence of phosphate ions on Cu(II) and Ni(II) binding at site II, as well as on kinetics of Ni(II) binding and substitution by Cu(II) at site...
- 9
- 627
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351 -SUT2 was constructed to contain SUT2 as the ... yeast/ info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively ... The cassette was amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA...
- 8
- 485
- 0
Báo cáo khoa học: Dissecting the role of the N-terminal metal-binding domains in activating the yeast copper ATPase in vivo pptx
... [36,37] The current hypothesis involves domain–domain interactions between the N-terminus and other domains of the ATPase Indeed, in vitro studies of the purified N-terminus and catalytic loop of the ... Wilson ATPase have shown that these two domains interact in the absence of copper and that their interaction is diminished by copper binding to the N-terminus [38] Such a domain–domain interaction ... expressed in Sf9 cells [36,40] It is currently thought that these inhibitory domain–domain interactions are relieved by binding of the metal to the N-terminus of the ATPase To further study the role of...
- 13
- 522
- 0
Báo cáo khoa học: The inhibition of Ras farnesylation leads to an increase in p27Kip1 and G1 cell cycle arrest pdf
... HR12 induces arrest of Rat1 /ras cells at the G1 phase of the cell cycle We next examined the effect of HR12 on the distribution of Rat1 /ras cells in the cell cycle To resolve the G1, S and G2/M phases, ... addition, and immunoblotted with anti -p27Kip1 Ig and with anti-actin Ig as a control The diagram shows quantification of the intensity of the p27Kip1 bands, calibrated to the intensity of the actin bands, ... and G1 arrest (Eur J Biochem 270) 2767 Fig HR12 treatment of Rat1 /ras cells leads to an increase in the level of p27Kip1 in the Cyclin E/Cdk2 complex and inhibition of cyclin E/Cdk2 kinase activity...
- 14
- 474
- 0
Báo cáo khoa học: Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen docx
... stroma 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 of breast carcinomas correlates with tumour recurrence Int J Cancer Res 58, 1–6 Lijnen, H.R (2002) Matrix metalloproteinases and cellular ... abrogate the invasion stimulating effects of plasminogen upon MDA-MB- 231 cells, confirming dependence upon plasmin activity [14] MMP -3 inhibition of MDA-MB- 231 invasion in the presence of plasminogen ... considered significant at P £ 0.05 RESULTS Inhibition of MDA-MB- 231 invasion by MMP -3 Human MDA-MB- 231 breast cancer cells constitutively express, MMP-9, low level MMP -3, TIMP-1, TIMP-2, uPA and t-PA but...
- 8
- 320
- 0
báo cáo hóa học: " Effects of betaine on lipopolysaccharide-induced memory impairment in mice and the involvement of GABA transporter 2" doc
... levels of glial markers and the betaine transporter Glial activation is also involved in the pathogenesis of LPS-induced memory impairment; therefore, to understand the effects of betaine on these ... - 13 - Effects of acute administration of betaine on LPS-induced memory impairment We further examined whether a single administration of betaine is able to prevent LPS-induced memory impairment ... injection, betaine plays a crucial role in preventing LPSinduced neuronal dysfunction On the other hand, a single administration of betaine, hr before LPS injection, did not prevent LPS-induced memory...
- 38
- 456
- 0
Báo cáo hóa học: " Inhibition of foot-and-mouth disease virus replication in vitro and in vivo by small interfering RNA" pot
... Rogel Arie, et al.: Inhibition of foot -and- mouth disease virus replication by small interfering RNA Journal of General Virology 2004, 85:3213-3217 Publish with Bio Med Central and every scientist ... Sharp PA: siRNA-directed inhibition of HIV-1 infection Nat Med 2002, 8:681-686 Shlomai A, Shaul Y: Inhibition of hepatitis B virus expression and replication by RNA interference Hepatology 2003, ... mononuclear cells by specific RNA interference Nucleic Acids Res 2002, 30:4830-4835 Capodici J, Kariko K, Weissman D: Inhibition of HIV-1 infection by small interfering RNA-mediated RNA interference...
- 6
- 256
- 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients and tissue specimens The Institutional Review Board of Kyushu University ... and 4b) These results suggest that GCT-CM enhanced the chemotaxis and cell proliferation of OPCs via VEGF-Flt-1-FAK signaling Possible involvement of the VEGF-Flt-1-FAK pathway in the bone destruction...
- 8
- 445
- 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx
... VEGF activates the VEGF-Flt-1-FAK pathway The activation of this signaling pathway might be involved in the migration of these cells into the lesion at the site of bone destruction in GCTs We recently ... order to determine the possible role of the VEGF-Flt-1-FAK pathway in the pathogenesis of bone destruction in GCTs Methods Patients and tissue specimens The Institutional Review Board of Kyushu University ... and 4b) These results suggest that GCT-CM enhanced the chemotaxis and cell proliferation of OPCs via VEGF-Flt-1-FAK signaling Possible involvement of the VEGF-Flt-1-FAK pathway in the bone destruction...
- 8
- 244
- 0
Báo cáo y học: "JNK pathway is involved in the inhibition of inflammatory target gene expression and NF-kappaB activation by melittin" ppsx
... [41] JNK pathway is also involved in IL-6 gene expression by enhancing NF-κB activity in human monocytes [42], as well as induction of proinflammatory responses in macrophages by the glycosylphosphatidylinositols ... region of the murine gene encoding iNOS and COX-2 contains NF-κB binding sites [15,48], which suggests that the inhibitory effect of inflammatory gene expression is related with the inhibition of the ... whether the suppressed effect of SP600125 on the inhibitory effect of bee venom and melittin on the inflammatory gene expression, iNOS and COX-2 expression was determined The inhibitory effect of...
- 13
- 388
- 0
Báo cáo y học: "EM703 improves bleomycin-induced pulmonary fibrosis in mice by the inhibition of TGF-β signaling in lung fibroblasts" doc
... significantly inhibited bleomycin-induced pulmonary fibrosis, suggesting that the mechanisms of action of EM703 against bleomycininduced pulmonary fibrosis in mice may involve not only anti-inflammatory ... significantly inhibited by EM703 (Figure 6) The mechanisms of inhibition by EM703 of bleomycininduced pulmonary fibrosis in mice may involve the inhibition of TGF-β signaling, mediating fibroblast proliferation ... early stage of inflammatory injury during bleomycin-induced pulmonary fibrosis, and the expression of Smad2 mRNA remained unchanged after bleomycin administration [44] The most common theory of the...
- 13
- 324
- 0
Role of misfolded nuclear receptor co repressor (n cor) induced transcriptional de regulation in the pathogenesis of acute monocytic leukemia (AML m5
... 1.2 The Nuclear Receptor Co- repressor (N- CoR), a component of the transcriptional repression machinery and its role in AML pathogenesis 1.2.1 The importance of the transcription machinery in the ... these factors become key initiators of AML pathogenesis 1.2.2 The Nuclear Receptor Co- Repressor (N- CoR) The nuclear receptor co- repressor N-CoR is a 270 kDa protein which is a key component of ... important role of the misfolded conformational dependent loss (MCDL) of NCoR in Acute Promyelocytic Leukemia (APL) Encouraged by the results in APL, we analyzed the status of N-CoR in other AML...
- 227
- 312
- 0
Inhibition of misfolded n cor induced survival pathway in APL by artemisinin
... INHIBITION OF MISFOLDED N- COR INDUCED SURVIVAL PATHWAY IN APL BY ARTEMISININ YEO HUI LING ANGIE (B.Sc.(Hons.), NTU) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF MEDICINE ... protein (Hsp) 70 chaperone family It consists of an N- terminal ATPase and a C-terminal substrate binding domain Conformational changes in GRP78 regulate its binding affinity for peptides in an ATP-dependent ... inhibit N- CoR misfolding in APL cells, possibly by inhibiting the phosphorylationdependent interaction between N- CoR and PML-RARα and subsequently dissociating N- CoR from PML-RARα This allows N- CoR...
- 96
- 159
- 0
Từ khóa: jh lim hj lee hj kim hd jeon r ryu jh 2008 quot inhibition of lipopolysaccharide induced inducible nitric oxide synthase and cyclooxygenase 2 expression by xanthanolides isolated from xanthium strumarium quot bioorg med chem lett 18 6 pp 2179 82h blé fx cannet c zurbruegg s fozard jr page cp beckmann n 2008 in vivo pharmacological evaluation of compound 48 80 induced airways oedema by mri british journal of pharmacology 154 5 1063 107228 kim j h jin y r park b s kim t j kim s y lim y hong j t yoo h s yun y p luteolin prevents pdgfbbinduced proliferation of vascular smooth muscle cells by inhibition of pdgf betareceptor phosphorylation 2005 biochem pharmacolua lee yh 2008 development of animal models of drug induced mitochondrial toxicity in will y dykens ja editors mitochondrial dysfunction in drug induced toxicity hoboken n j wileyk nonami t nakao a harada a kurokawa t sugiyama s fujitsuka n shimomura y hutson sm harris ra takagi h 1996 the valine catabolic pathway in human liver effect of cirrhosis on enzyme activities hepatology 24 1395 1398micrornas mirnas are noncoding regulatory rnas that function via the degradation of target mrnas and inhibition of translation they are found widely in higher eukaryotic organismscall of the wild quotes about survivalbenefits and risks of manipulating the hif hydroxylase pathway in ischemic heart disease18 in april 10 2000 of cambodia ninhibition of platelet aggregationh1 pd 1 pathways in the inhibition of t cell activationaddressing the role of promoting the acquisition of the prosocial triad and other survival skills in youthsulfur in the alleviation of cadmium induced oxidative stress in plantsobserved inhibition of neutrophil activation by surfactant with sp b cp21waf1 cip1 and rb e2f pathway in regulation of dnmt1Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ