0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

In vitro and in vivo characterisation of recombinant lactobacilli expressing house dust mite allergen

In vitro and in vivo characterisation of recombinant lactobacilli expressing house dust mite allergen

In vitro and in vivo characterisation of recombinant lactobacilli expressing house dust mite allergen

... IN VITRO AND IN VIVO CHARACTERIZATION OF RECOMBINANT LACTOBACILLI EXPRESSING HOUSE DUST MITE ALLERGEN LIEW LEE MEI 2009 IN VITRO AND IN VIVO CHARACTERIZATION OF RECOMBINANT LACTOBACILLI EXPRESSING ... Chapter 4: The in vivo evaluation of the recombinant lactobacilli 97-133 in mouse allergy models 4.1 Introduction 97 4.2 Results 100 The immunogenicity of recombinant lactobacilli in vivo 100 4.2.1.1 ... evaluation of in vivo 101 immunogenicity of the Blo t expressed in recombinant lactobacilli Figure 4.2 Oral feeding of recombinant Lactobacillus plantarum NC8 104 induced the production of Blo t...
  • 193
  • 613
  • 0
In vitro and ex vivo effect of hyaluronic acid on erythrocyte flow properties pps

In vitro and ex vivo effect of hyaluronic acid on erythrocyte flow properties pps

... with variable HA concentrations, and reversibility of HA effect In vitro effect of several .hyaluronic acid (HA) concentrations on rigidity index (RI) Each sample was fractioned in aliquots (1 ml) ... interpretation of data of erythrocyte aggregation of the in vitro experiments GP: acquisition, analysis and interpretation of data of erythrocyte deformability of the in vitro experiments RV and SP: protocol ... Consequently, its increase may be explained by the rise in fibrinogen and/ or globulin concentration and/ or to the modification of the erythrocyte surface properties In our in vitro experiments, it...
  • 7
  • 221
  • 0
Báo cáo y học:

Báo cáo y học: "Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy" ppsx

... However, our investigation showed that DNA vaccination successfully reduced the recruitment of inflammatory cells in lung tissues The effect of DNA vaccination in allergic inflammation might be ... N, Yoo TJ: The effect of vaccination with DNA encoding murine T-cell epitopes on the Der p and induced immunoglobulin E synthesis Allergy 2001, 56:741-748 Lewis DB: Allergy immunotherapy and inhibition ... histopathology in an animal model of allergy Effect of2 Effect of genetic vaccination on lung histopathology in an animal model of allergy A and B, Light microscopic examinations of lung tissue from control...
  • 9
  • 297
  • 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
  • 9
  • 422
  • 0
Báo cáo y học:

Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

... and cellular responses; and analysis of T-cell proliferation LG contributed to CIA induction and evaluation and to analysis of T-cell proliferation PM contributed to the design of the study and ... inhibition of T-cell proliferation was demonstrated by the addition of inhibitors of these enzymes - GW274150 and indomethacin [8,36], respectively - to the co-cultures The addition of these inhibitors ... Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis Arthritis Research & Therapy 2010 12:R31 Submit your next manuscript...
  • 11
  • 464
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains" pptx

... point, a direct comparison of the pathogenecity of these strains is difficult to make In this context, the aim of the present study is to compare the in vitro and in vivo properties of these two ... to the sensitivity of the ELISA test available In the case of animal 191, as discussed above, the reason could have been the lack of infection Page of Conclusions The in vitro and in vivo properties ... Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains Acta Veterinaria Scandinavica 2011 53:37 Submit your next manuscript to BioMed Central and take...
  • 8
  • 366
  • 0
Báo cáo y học:

Báo cáo y học: "In vitro and in vivo evaluation of a new active heat moisture exchange" potx

... Performer and the Hygrobac had significantly higher airway temperature and AH than did the Hygroster (Fig 5) Active Performer, regardless of the level of heating, always had a higher temperature and AH ... inspiratory flow; VT = tidal volume Statistical analysis All data are expressed as mean ± standard deviation For the in vitro study, we compared the three HMEs using a one-way analysis of variance ... evaporation In the present study we assessed the efficiency and stability of this new active moisture exchanger in delivering heat and moisture to inspired gases, as compared with widely used heat and moisture...
  • 8
  • 360
  • 0
In vitro and in vivo study of ABT 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors  insight into molecular mechanism and biologic characterization

In vitro and in vivo study of ABT 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors insight into molecular mechanism and biologic characterization

... In vitro and In vivo study of ABT- 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors: insight into molecular mechanism and biologic characterization ... target of STAT3 3.3.9 In vivo efficacy of IDR E804 in combination with ABT- 869 for treatment of MV4-11-R mouse xenografts 69 Discussion 73 References 78 Chapter The combination of HDAC Inhibitors and ... CalcuSyn software for (A) simultaneous combination of ABT- 869 with Ara-C, (B) simultaneous combination of ABT- 869 and Dox , (C) pretreatment with ABT- 869 first followed by Ara-C, (D) pretreatment with...
  • 121
  • 368
  • 0
In vivo and in vitro studies of th17 response to specific immunotherapy in house dust mite induced allergic rhinitis patients

In vivo and in vitro studies of th17 response to specific immunotherapy in house dust mite induced allergic rhinitis patients

... the twenty patients with significant response to the treatment were used in the following in vivo and in vitro studies 3.3 In vitro Study To mimic the functional response of Th17 and other Th ... e91950 Th17 Response to Immunotherapy in Allergic Rhinitis PLOS ONE | www.plosone.org March 2014 | Volume | Issue | e91950 Th17 Response to Immunotherapy in Allergic Rhinitis Figure Determination of ... e91950 Th17 Response to Immunotherapy in Allergic Rhinitis PLOS ONE | www.plosone.org March 2014 | Volume | Issue | e91950 Th17 Response to Immunotherapy in Allergic Rhinitis Figure Determination of...
  • 11
  • 297
  • 0
In vitro and in vivo assessments of PCL TCP composites for bone tissue engineering

In vitro and in vivo assessments of PCL TCP composites for bone tissue engineering

... bone tissue engineering for an ideal bone substitute 1.1.3 Strategies in BTE Tissue engineering is the restoration, improvement, maintenance and substitution of damaged tissues and organs using ... will be in solutions (Lakes, 2007) TCP is found naturally in the inorganic phase of bone in form of hydroxyapatite TCP is also responsible for the hardness of bone, dentine and enamel TCP exhibit ... 70-90% of minerals with the rest in the form of proteins Within the proteins in bone, the ratio of collagenous to noncollagenous stands at 9:1 This is in stark contrast with other tissues consisting...
  • 94
  • 546
  • 0
In vitro and in vivo evaluation of customized polycaprolactone tricalcium phosphate scaffolds for bone tissue engineering

In vitro and in vivo evaluation of customized polycaprolactone tricalcium phosphate scaffolds for bone tissue engineering

... submitted for the degree of Master of Engineering in the Department of Mechanical Engineering at the National University of Singapore under the supervision of Professor Teoh Swee Hin and Dr Alvin Yeo ... secrete bone tissue and form the tissue around itself like a protective wall of bone tissue They are responsible for the maintenance of healthy bone by secreting enzymes and directing the bone mineral ... CHAPTER 4: OPTIMIZATION OF NATIVE AND CUSTOMIZED SCAFFOLDS IN VITRO AND THEIR EFFECTS IN INITIAL BONE HEALING 4.1 INTRODUCTION 44 4.1.1 In vitro degradation study 44 4.1.2 In vivo degradation study...
  • 143
  • 472
  • 0
In vitro and in vivo evaluation of transferrin conjugated lipid shell and polymer core nanoparticles for targeted delivery of docetaxel

In vitro and in vivo evaluation of transferrin conjugated lipid shell and polymer core nanoparticles for targeted delivery of docetaxel

... IN VITRO AND IN VIVO EVALUATION OF TRANSFERRIN- CONJUGATED LIPID SHELL AND POLYMER CORE NANOPARTICLES FOR TARGETED DELIVERY OF DOCETAXEL PHYO WAI MIN (M.B.,B.S (YGN) U.M(1)) ... the synthesis and characterization of transferrin conjugated lipid shell and polymer core nanoparticles are discussed in Chapter In Chapter 5, in vitro cellular study of transferrin conjugated LPNPs ... Organization In this thesis, formulations of lipid shell and polymer core nanoparticles are developed for the clinical administration of docetaxel At the same time, the effect of different lipids used in...
  • 129
  • 286
  • 0
In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel

In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel

... IN VITRO AND IN VIVO INVESTIGATION OF NANOPARTICLES OF A NOVEL BIODEGRADABLE COPOLYMER FOR SUSTAINED AND CONTROLLED DELIVERY OF DOCETAXEL GAN CHEE WEE (B.Eng (Hons.), NUS) A THESIS SUBMITTED ... many anticancer drugs, including docetaxel, by internalization mechanism of drug-loaded nanoparticles such as endocytic process (Panyam and Labhasetwar, 2003; Bareford and Swaan, 2007) Meanwhile, ... potential biomedical applications, including formulation of imaging agents for cellular and molecular imaging and targeted drug therapy (Zhang et al., 2007; Pan and Feng, 2009) 1.2 Objectives and...
  • 163
  • 932
  • 0
In vitro and in vivo study of vitamin e TPGs coated immunoliposomes for sustained and targeted delivery of docetaxel

In vitro and in vivo study of vitamin e TPGs coated immunoliposomes for sustained and targeted delivery of docetaxel

... the herceptin conjugated liposomes Thus the herceptin conjugated Vitamin E TPGS coated liposomes showed greater potential for sustained and targeted chemotherapy in the treatment of HER2 over expressing ... have been discovered and developed since the past few decades Together with the problems faced in traditional ways in which cancer patients are treated, this regimen has even become more and ... formulations were provided Then, Chapter presents the preparation and characterization vitamin E TPGS coated and herceptin conjugated liposomes The liposomes were prepared by solvent injection method and...
  • 121
  • 326
  • 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the ... B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted using...
  • 7
  • 391
  • 0

Xem thêm

Từ khóa: research studies of qigong therapy for cancer for the past 20 years in china were reviewed from three different categories clinical study on human cancer patients in vitro study of cancer cells and in vivo study of cancer with qigong therapin vitro and in vivo analysis of the cellin vitro and in vivo degradation of phytateapos apos 8p specific apos apos microarrays two novel metastatic suppressors were identified and proved to suppress in vitro invasion and in vivo metastasis of hccnanobiosensors for in vitro and in vivo analysis of biomoleculesvitro ex vivo and in vivo roles of mscsin vitro in vivo correlation of the causal relationship between cigarette smok ing and higher incidence of carcinomasin vitro and in vivo analyses of regulatory t cell suppression of cd8 t cellsin vitro in vivo extrapolation of drug diffusion velocity and p gp efflux rate parametersoverexpression purification and in vivo reconstitution of hexahistidine tagged wild type and b d186 433 corsearching for in vivo traces of mesenchymal stem cells and their ancestorsex vivo and in vivo effects of pnavitro in vivo scaling of drug interactionsintegrated proteomics technologies and in vivo validation of molecular targetsin vivo studies of brain oxygen metabolism and oxidative phosphorylationNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ