0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Detection of biologically relevant anions by fluorescence and NIR molecular probes

Detection of biologically relevant anions by fluorescence and NIR molecular probes

Detection of biologically relevant anions by fluorescence and NIR molecular probes

... DETECTION OF BIOLOGICALLY RELEVANT ANIONS BY FLUORESCENCE AND NIR MOLECULAR PROBES QUEK YI LING (B Sc.(Hons.), National University of Singapore) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Results and discussion .140 6.3.1 Synthesis of complexes and 140 6.3.2 Spectroscopic characterization of complexes and .142 6.3.3 Comparison of NIR band shift for [Fe2]4+, 1, and ... convenient way for the detection of the HS− generation rate of a H2S donor of medical importance The addition of π-acceptor ligands such as cyanide and isocyanide ligands to the NIR active isovalent...
  • 211
  • 800
  • 0
Multi wall carbon nanotubes (MWCNTs) doped polypyrrole DNA biosensor for label free detection of genetically modified organisms by QCM and EIS

Multi wall carbon nanotubes (MWCNTs) doped polypyrrole DNA biosensor for label free detection of genetically modified organisms by QCM and EIS

... screening in DNA detection approach (this approach is more often used than the second one of protein detection because DNA stability is much higher than that of proteins and therefore DNA detection ... study, we described the setup of a novel DNA label- free electrochemical biosensor for GMO (soybean) detection, based on MWCNT -doped PPy matrices for ODN immobilization and hybridization Experimental ... electropolymerization of C-PPy-ODN film Results and discussion 3.1 Film formation and morphology Normally, sensitivity and reproductibility of DNA sensors are determined by the surface chemistry of the recognition...
  • 6
  • 275
  • 2
Báo cáo khoa học: Glycation and glycoxidation of low-density lipoproteins by glucose and low-molecular mass aldehydes Formation of modified and oxidized particles pot

Báo cáo khoa học: Glycation and glycoxidation of low-density lipoproteins by glucose and low-molecular mass aldehydes Formation of modified and oxidized particles pot

... glucose and two aldehydes (MG and GA) in inducing lipid and protein oxidation and antioxidant depletion of LDL particles as well as glycation of the apoB protein by measuring specific parameters of ... course, and extent of the covalent and oxidative changes that occur on LDL particles exposed to glucose, GA, and MG have been quantified in order to determine the significance of glycation and glycoxidation ... accumulation of this oxidation product is unaffected by the level of hyperglycaemia The absence of any effect of glucose on Cu2+-stimulated oxidation is, however, in Ó FEBS 2003 Glycation and glycoxidation...
  • 11
  • 401
  • 0
Báo cáo khoa học: Fluorescence quenching and kinetic studies of conformational changes induced by DNA and cAMP binding to cAMP receptor protein from Escherichia coli ppt

Báo cáo khoa học: Fluorescence quenching and kinetic studies of conformational changes induced by DNA and cAMP binding to cAMP receptor protein from Escherichia coli ppt

... uorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli Eur J Biochem 270, 14131423 Yu S & Lee JC (2004) Role of residue ... changes induced by DNA and cAMP 19 20 21 22 23 24 25 26 27 28 29 30 31 cAMP -induced allosteric changes in T127I, S128A and T127I S128A mutants of cAMP receptor protein from Escherichia coli J ... CRP conformational changes induced by DNA and cAMP i.e free CRP, CRP (cAMP) 2 and CRP (cAMP) 4 In the presence of % 100 lm cAMP, the protein becomes activated by the formation of a CRP (cAMP) 2...
  • 14
  • 400
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy" pptx

... Cite this article as: Hong et al.: Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy ... determination of a protein Page of Fabrication of the gold nanoisland substrate The gold nanoisland was prepared by the thermal evaporation on a glass substrate (0.8 × 7.0 cm) in a vacuum at a temperature ... view of a heteroliganded gold nanoisland for the sensitive and molecular size-selective detection of a protein The enlarged schematic diagram shows the surface morphology of a heteroliganded gold...
  • 7
  • 432
  • 0
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

... slightly The hepatocytes exhibited similar characteristics Effect of chelators on uptake of NTBI The effects of the chelators on NTBI uptake by hepatocytes and Q7 hepatoma cells were marked and similar ... Characterisation of citrate and iron citrate uptake by cultured rat hepatocytes J Hepatol 29, 603–613 27 Trinder, D & Morgan, E.H (1997) Inhibition of uptake of transferrin-bound iron by hepatoma cells by ... internalization of NTBI by normal and iron- loaded hepatocytes, and on Fe internalized from NTBI by normal and ironloaded hepatocytes For uptake assays, cells were incubated for h at 37 °C in the presence...
  • 10
  • 545
  • 0
Tài liệu Báo cáo khoa học: Oxygen-dependent regulation of hypoxia-inducible factors by prolyl and asparaginyl hydroxylation pdf

Tài liệu Báo cáo khoa học: Oxygen-dependent regulation of hypoxia-inducible factors by prolyl and asparaginyl hydroxylation pdf

... mechanism of regulation of both domains involves a common iron dependent process [74,75,79] Regulation of HIFa subunits by oxygen-dependent prolyl and asparaginyl hydroxylation A variety of oxygen ... Moreover, Fig Regulation of hypoxia inducible factors (HIF) by oxygen-dependent hydroxylation In oxygenated conditions (normoxia) the asparaginyl and HIF prolyl hydroxylases (FIH-1 and PHD/HPH) ... rapid turnover and transcriptional silencing of the HIFa protein subunits involves oxygen-dependent prolyl and asparaginyl hydroxylation by the PHD/ HPHs and FIH-1 proteins, respectively These modifications...
  • 10
  • 603
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx

... Compound Nouns based on Character Cooccurrence and Its Evaluation (in Japanese) Journal of Natural Language Processing, 4(3):83-99 Masahiro Oku 1994 Handling Japanese Homophone Errors in Revision ... of elements of the homophone set increases Our method has an advantage that the size of DL1 is smaller The size of the decision list has no relation to the precision and the recall, but a small ... Construction of DL1 is, DL1 is the decision list to attach the written word as the default evidence to a (see Fig.l) Next, we calculate the precision and the recall of DL1 Because a of DL1 is the same as...
  • 8
  • 588
  • 0
Tài liệu Báo cáo Y học: Regulation of transcription of the Dnmt1 gene by Sp1 and Sp3 zinc finger proteins doc

Tài liệu Báo cáo Y học: Regulation of transcription of the Dnmt1 gene by Sp1 and Sp3 zinc finger proteins doc

... through the same GA motif Sp1 and Sp3 bound to the same cis-element in the promoter of the gene for Dnmt1 Therefore, we next examined whether activation by Sp1 or by Sp3 affect expression of the gene ... stimulated by either pPacSp1 or pPacUSp3 (Fig 4C,D) These results indicate that both Sp1 and Sp3 enhanced transcription from the Dnmt1 promoter Independent activation of the Dnmt1 promoter by Sp1 and Sp3 ... of both Sp1 and Sp3, the ratio of Sp1 to Sp3 is higher than in nonendothelial cells [35] In primary keratinocytes, levels of Sp3 exceed those of Sp1 The ratio of Sp3 to Sp1 is inverted when these...
  • 10
  • 563
  • 0
Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc

Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc

... lysed in 100 lL of SDS/PAGE sample buffer by boiling for min, proteins were resolved by means of 7.5% SDS/PAGE and analysed by immunoblotting with monoclonal anti-(P-Tyr) antibody followed by ... Evidence of a laminin binding protein on the surface of Leishmania donovani Biochem Biophys Res Commun 226, 101–106 Ghosh, A., Bandyopadhyay, K., Kole, L & Das, P.K (1999) Isolation of a laminin -binding ... EGF -like motif of laminin is responsible for high affinity nidogen binding EMBO J 12, 1879–1885 10 Ancsin, J.B & Kisilevsky, R (1997) Characterization of high affinity binding between laminin and...
  • 8
  • 420
  • 0
Find-A-Ride: A listing of TLC Licensed Bases by Borough and by Zip Code pdf

Find-A-Ride: A listing of TLC Licensed Bases by Borough and by Zip Code pdf

... OCEAN AVENUE 718-676-0126 Paratransit B90605 ALMAZ TRANSPORTATION INC 2313 AVENUE X 718-769-5600 Paratransit B90537 ALTA MEDICAL TRANSPORTATION, INC 2834 CONEY ISLAND AVENUE 212-202-5555 Paratransit ... FIRST CLASS C/L SVC CORP 4980 BROADWAY NEW YORK, NY Last updated Thursday, February 07, 2013 Page of 70 Manhattan Name of Base Street Address Telephone Base Type License # SEAMAN RADIO DISPATCHERS ... GUY'S CAR SVCE 1845 ROCKAWAY PARKWAY DREAMLAND CAR & LIMO.SVC INC 9732 SEAVIEW AVENUE GEORGE TOWN MANAGEMENT INC 919 EAST 107 STREET TRANSIT PVT C/S INC 1417 ROCKAWAY PARKWAY JAH LOVE 582 EAST 88...
  • 70
  • 615
  • 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... of polyneuridine aldehyde into epi-vellosimine This central reaction of the pathway is catalysed by the enzyme polyneuridine aldehyde esterase (PNAE) The QuikChangeTM in vitro Site-Directed Mutagenesis ... Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen,...
  • 8
  • 345
  • 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... BA & Maki M (20 03) Analysis of epidermaltype transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes using monoclonal antibodies J Dermatol Sci 32 , 95–1 03 ... Baxa U & Steinert P (20 03) Roles of calcium ions in the activation and activity of the transglutaminase enzyme J Biol Chem 278, 238 34– 238 41 30 Hitomi K, Presland RB, Nakayama T, Fleckman P, Dale ... specific for TGase in principle, because cadaverine is an amine substrate known to react with any active TGase Although aberrant TGase activity has been reported in several skin diseases, as a consequence...
  • 11
  • 645
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Unsupervised Detection of Downward-Entailing Operators By Maximizing Classification Certainty" docx

... smaller list of NPIs as a seed set Begin with a small set of seed NPIs Iterate: (a) Use the current list of NPIs to learn a list of DEOs (b) Use the current list of DEOs to learn a list of NPIs Interestingly, ... as a generalization of this evaluation procedure that is sensitive to the ranking of DEOs and non-DEOs For development purposes, we use the list of 150 annotations by DLD09 Of these, 90 were DEOs, ... to the distillation method of DLD09 In particular, the numerator of (17), which we just showed to be equal to the estimate of P (Y ) given by (16), is exactly the sum of the responsibilities for...
  • 10
  • 279
  • 0

Xem thêm

Từ khóa: the art and science of low carbohydrate living by phinney and volekprinciples of marketing 14th edition by kotler and armstrongthe art and science of low carbohydrate living by volek and phinneyvisualization of mouse embryo angiogenesis by fluorescence based staining—all operating banks amount of agricultural loans outstanding by type and by states specified dates 1996 99—all operating banks amount of agricultural loans outstanding by type and by states specified dates 1998 2001revenues of title iv institutions by level and control of institution accounting standards utilized and source of funds united states fiscal year 2010expenses of title iv institutions by level and control of institution accounting standards utilized and type of expense united states fiscal year 2010burm f nees of brunei darussalam determined by rapd and pcr rflp analysesforum waiver of right to trial by jury and choice of lawburden of disease in dalys by cause and broad age group countries grouped by income per capita 2004bonding requirements for the extraction of federally owned resources by agency and resource• building a european facility to simulate the working of the human brain by developing and using supercomputers and neuromorphisolation of muscle stem cells by fluorescence activated cell sorting cytometry2metabolism of polycyclic aromatic hydrocarbons by fungi and yeastsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI