A quest for identity returnee filmmakers and postwar shanghai cinema, 1945 1949
A quest for identity returnee filmmakers and postwar shanghai cinema, 1945 1949
... Library and Peking University Library I want to thank my graduate classmates Fan Xue, Fan Rui, Ji Xing, Wang Yue and Ma Jilian, for providing a stimulating and fun environment in which to learn and ... and melodrama ambiguously The study of returenee filmmakers provides an opportunity to break through the boundaries of geography (the Great Rear Area /Shanghai) and producers (filmmakers/ drama ... actual situation of migrated filmmakers in postwar shanghai cinema history, even in the whole modern China The thesis explores the relation between returnee filmmakers and postwar culture practice,...
- 93
- 479
- 0
Intercultural performance as a paradigm for identity and discourse
... performance as a critical paradigm to examine the developments and limitations of existing intercultural Shakespeare studies As Craig Dionne and Parmita Kapadia assert, local Shakespeare performances ... Shakespeare Scholarship on what Shakespeare, Asian Shakespeare, intercultural Shakespeare and contemporary Shakespearean adaptation and appropriation is, or rather, can be Therefore, it is imperative ... of interculturalism have affected and effected our understanding and theorizing of past and present Asian (intercultural) Shakespeare performances For instance, is there value in naming Asian...
- 131
- 616
- 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... Fig K562 cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... The band at 2963 cm)1 can be assigned to the asymmetric stretching of CH3, and the band at 2873 cm)1 to its symmetric mode The bands at 2926 and 2853 cm)1 can be assigned to an asymmetric and ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...
- 6
- 555
- 0
Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc
... in Belgium, love and happiness in Japan; red is associated with luck in China and Denmark, but with bad luck in Nigeria and Germany and reflects ambition and desire in India Some expressions involving ... compared to basic emotions in E MO L EX Therefore, it may be introducing some ambiguous color -emotion associations Finally, we investigate cross-cultural differences in color -emotion associations ... with English, and color preferences This data is useful for investigating variance in annotations for color -emotion -concept associations among workers from different cultural and linguistic backgrounds...
- 9
- 527
- 0
Báo cáo khoa học: "A Procedure for Multi-Class Discrimination and some Linguistic Applications" pptx
... implemented in a uniform way (in all three cases by converting a logic formula - either CNF or something more complicated - into a DNF formula), and all can use both sound and unsound (but good) ... P -and- Q, Por-Q, P-iff-Q, P-implies-Q, and Q-implies-P • Two nominal features M and N are combined into a single two-place nominal function MxN • Two numeric features X and Y are combined by forming ... processed dataset, for a number of languages there were missing values, esp for features II (12) through (14) The linguistic reasons for this were two-fold: (i) lack of reliable information; or (ii)...
- 7
- 364
- 0
A Quest for Global Peace ppt
... global peace- 01 pre.fm Page i Friday, August 18, 2006 5:05 PM A Quest for Global Peace global peace- 01 pre.fm Page ii Friday, August 18, 2006 5:05 PM global peace- 01 pre.fm Page iii Friday, August ... of nuclear weapons and of war Daisaku Ikeda President, Soka Gakkai International global peace- 03 pref2.fm Page xvi Friday, August 18, 2006 5:06 PM global peace- 04 ch01.fm Page Friday, August 18, ... Institute for Global Peace and Policy Research, which I founded, and to thank you again for rushing all the way to Okinawa to attend On that occasion you were awarded the Toda Prize for Peace Research;...
- 175
- 514
- 0
A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx
... is theater airlift planning and execution operational tasks Theater airlift planning and execution operational tasks support the theater airlift planning and execution operational objectives They ... and the analysis of the theater airlift planning and execution system, we documented the AS-IS theater airlift planning and execution system and compared it with the attributes derived from applying ... all movements of materiel and personnel within the AOR by land (trucks and rail), sea (ships and barges), and air and for the Joint Movement Center (JMC) to the Air Force Although typically an Army...
- 151
- 453
- 0
Báo cáo khoa học: "a Toolkit for Distributed Perceptron Training and Prediction with MapReduce" doc
... serially on all the training data with the distributed perceptron trained with iterative parameter mixing with variable number of splits S ∈ {10, 20} For each system, we report the prediction accuracy ... Perceptron Training, Prediction and Evaluation for a distributed MapReduce framework It is a versatile stand alone software or building block, that can be easily extended, modified, adapted, and ... the training, prediction and evaluation modules for several sequence labeling tasks including part-of-speech tagging and named entity recognition Experiments We investigate HadoopPerceptron training...
- 5
- 433
- 0
báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc
... beyond health behaviour and administration into all public health disciplines and to establish undergraduate and doctoral programmes in public health that would serve the needs of state and local agencies ... in the strategic assessment As summarized in Figure 5, the Department has had a string of rapid successes and ambitious plans for attaining status as a school of public health in the next decade ... establishing a thriving research base that emphasized population health and health behaviour research while generating responsive and progressive health and human service training programmes The...
- 10
- 577
- 0
Báo cáo hóa học: " Research Article A Framework for System-Level Modeling and Simulation of Embedded Systems Architectures" ppt
... usage of set and script elements ...
- 11
- 400
- 0
ASTM A 53_SPECIFICATION FOR PIPE, STEEL, BLACK AND HOT-DIPPED, ZINC-COATED, WELDED AND SEAMLESS SA-53/SA-53M ppt
... gaging practice and tolerances of ANSI B1.20.1 For standard-weight pipe NPS [DN 150] and smaller, refer to Table X3.1 for threading data For standardweight pipe NPS [DN 200] and larger and all sizes ... couplings for standard-weight pipe and taper-tapped couplings for extra-strong and double extrastrong pipe If taper-tapped couplings are required for pipe NPS [DN 50] and smaller on standard-weight pipe, ... PART A — FERROUS MATERIAL SPECIFICATIONS A 865 Specification for Threaded Couplings, Steel, Black and Zinc-Coated (Galvanized) Welded or Seamless, for Use in Steel Pipe Joints B Specification for...
- 28
- 701
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... Colosia AD, Donahue JP, Lin YZ, Hawiger J: Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization ... stress-activated protein kinases, also called cJun NH2-terminal kinases (JNKs); and the p38 MAPKs [13] The JNK pathway is of interest because of its capacity to phosphorylate the amino acids serine-63 ... protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense...
- 10
- 462
- 0
Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt
... reindeer (Rangifer tarandus tarandus) Acta Physiol Scand 2000, 170, 145-151 Moen AN: Seasonal changes in heart rates, activity, metabolism, and forage intake of white-tailed deer J Wildl Manage ... Definition Lying Lying passively Standing Standing passively Locomotion Moving, walking or running Running Constant running under human harassment Eating Animal inside the feeding area ingesting feed ... heart rates of reindeer calves in relation to different behaviour categories Data for each behaviour category has been calculated as an average of individual mean values The box-plot presentation...
- 10
- 239
- 0
microsoft access a primer for relational database design and use
... Summary MS -Access is a powerful relational database program It has many integrated features and can be greatly customized to fit most personal/departmental needs for data collection and storage ... Microsoft Access – Module An Overview of MS -Access PA Harris, Vanderbilt University What is Microsoft Access? Microsoft Access is a relational database management system (DBMS or RDBMS) At ... II type grants) PA Harris, Vanderbilt University What is in an MS -Access file - 1? Although the term database typically refers to a collection of related data tables, an Access database includes...
- 38
- 443
- 0
Từ khóa: qualitative research practice a guide for social science students and researchers jane ritchiea rose for emily literary response and analysis questionsa rose for emily literary response and analysis answersa framework for evaluating control exceptions and deficiencieshow to make a website for free on google and make moneya handbook for measuring customer satisfaction and service quality part bmolecular typing of bacterial pathogens a tool for the epidemiological study and control of infectious diseasesa challenge for the presumptive endoscopic and histologic diagnosis of autoimmune gastritisa resource for reading and wordsecosystems and human well being a framework for assessment citationecosystems and human well being a manual for assessment practitionersecosystems and human well being a framework for assessmentecosystems and human wellbeing a manual for assessment practitionersliterary response and analysis a rose for emilyecosystems and human well being a framework for assessmentNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ