Pile behaviour subject to excavation induced soil movement in clay
Pile behaviour subject to excavation induced soil movement in clay
... matrix of soil {Pp} Vector of pile- soil interaction forces acting on pile {Ps} Vector of pile- soil interaction forces acting on soil {yo} Vector of lateral soil movements at the pile nodes in the ... (2001) to study the responses of a single pile and pile groups due to excavation- induced soil movement in sand It was reported that the induced bending moment on the piles increased with excavation ... experiments to study the behaviour of two, four and six -pile groups in dense sand The above experiments provided a fundamental insight to explain the pile behaviour subject to excavation- induced soil movement...
- 298
- 472
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG ... ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible...
- 13
- 563
- 0
Báo cáo y học: "Intra-abdominal hypertension due to heparin induced retroperitoneal hematoma in patients with ventricle assist devices: report of four cases and review of the literature" pdf
... al.: Intra-abdominal hypertension due to heparin - induced retroperitoneal hematoma in patients with ventricle assist devices: report of four cases and review of the literature Journal of Cardiothoracic ... reduced, and the patient remained clinically stable under dobutamin & dopamine and heparin IV Heparin therapy was monitored three times per day, using the partial thromboplastin time (aPTT) and the ... according to the World Society of the Abdominal Compartment Syndrome The mortality rate in patients with IAH and ACS varies from 29 to 62% and is usually due to multiple organ failure and sepsis...
- 10
- 480
- 0
Báo cáo y học: " Renal haemodynamic, microcirculatory, metabolic and histopathological responses to peritonitis-induced septic shock in pigs" ppt
... only, without providing their relationship to microcirculatory, metabolic and histopathological responses Prompted by these facts, we dynamically assessed the pattern of renal haemodynamics in ... porcine model of progressive hyperdynamic sepsis induced by faecal peritonitis Furthermore, a potential link between renal haemodynamics and renal cortex microcirculatory, metabolic and histological ... sham-operated and peritonitisinduced pigs at baseline Systemic variables Haemodynamic and oxygen exchange parameters, inflammatory responses, oxidative and nitrosative stress, and other laboratory parameters...
- 8
- 373
- 0
behaviour of pile groups subjected to torsion
...
- 365
- 123
- 0
Behaviour of caisson breakwater subject to breaking waves
... movements of caisson subjected to strong waves 220 6.20 Total movements of caisson subjected to strong waves 221 6.21 Comparisons of analytical data with the field data of Typhoon ... Comparisons of measured and analytical total movements of caisson breakwater subject to wave loading during 51465-51510 s in WL7 (RD=80%)219 6.18 Elastic movements of caisson subjected to strong waves ... BEHAVIOUR OF CAISSON BREAKWATER SUBJECT TO BREAKING WAVES ZHANG XI YING (M.E., HUST) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CIVIL ENGINEERING...
- 275
- 210
- 0
a subject to study
...
- 1
- 924
- 0
Tài liệu International Standard Banking Practice for the Examination of Documents under Documentary Credits subject to UCP 600 (ISBP) pdf
... the International Standard Banking Practice for the Examination of Documents under Documentary Credits (ISBP), ICC Publication 645 This publication has evolved into a necessary companion to the ... companion to the UCP for determining compliance of documents with the terms of letters of credit It is the expectation of the Drafting Group and the Banking Commission that the application of the principles ... set of bills of lading is presented under one draft, the date of the last bill of lading will be used for the calculation of the maturity date While the examples refer to bill of lading dates, the...
- 36
- 818
- 1
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt
... TK1 In the first crystal structure of TK1- type enzymes of human and mycoplasmic origin [14], the feedback inhibitor dTTP was bound in the substrate pocket, similar to the binding of dTTP to the ... efficiency of ATP-incubated hTK1 is approximately 30-fold higher than that of non-incubated hTK1 The two TK1 forms can therefore be referred to as the high- and lowefficiency forms To explain the apparent ... form As the hTK1 concentration increases during S phase, more and more enzyme will be in the high- active tetramer form Recently, phosphorylation of hTK1 at serine 13 has been proposed to be involved...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Upregulation of DR5 by proteasome inhibitors potently sensitizes glioma cells to TRAIL-induced apoptosis doc
... clear trend towards an apoptosis- inhibitory effect of the DR5 knockdown, indicating that basal expression of DR5 is required for the TRAIL sensitivity in these cells Apoptosis induced by TRAIL in ... reactivation of TRAIL-induced apoptosis observed in malignant glioma cells To address this question, we knocked down expression of DR5 by small interfering RNA (siRNA) duplexes targeted against DR5 mRNA ... is of note that this lack of apoptosis reactivation was independent of the p53 status of these cells, as U343 cells, but not U373 cells, have been shown to express functional p53 [14,15] PIs potently...
- 12
- 440
- 0
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... of PrPC-induced cell drug resistance in gastric cancer cells PI3K/Akt is involved in the activation of P-gp by PrPC in gastric cancer To further investigate the underlying mechanism of PI3K/Akt- mediated ... significantly increased The results indicate that inhibition of the PI3K/Akt signaling pathway may lead to inhibition of the MDR induced by PrPC in gastric cancer cells The mechanism underlying PI3K/Akt- mediated ... PI3K/Akt is involved in PrPC-mediated MDR in gastric cancer In order to study whether activation of the PI3K/Akt signaling pathway played a role in PrPC-induced MDR in gastric cancer cells, the...
- 10
- 448
- 0
50% OFF ALL CHARLTONS OAK FURNITURE THIS MONTH ONLY! ALL PRICES INCLUDE VAT AND ARE SUBJECT TO STOCK AVAILABILITY. docx
... laquered oak top Please state which finish is required when ordering List Price Sale Price Code 3' Oak sleigh bed £648.00 £324.00 LIHFB30 3' Oak sleigh bed Rainbow £796.00 £398.00 LIHFB30RA 4'6" Oak ... £498.00 LIHFB46 4'6" Oak sleigh bed Rainbow £1,196.00 £598.00 LIHFB46RA 5'0 Oak Sleigh bed £1,116.00 £558.00 LIHFB50 5'0 Oak Sleigh bed Rainbow £1,396.00 £698.00 LIHFB50RA 6'0 Oak Sleigh bed £1,300.00 ... £144.00 £158.00 £168.00 Farrington chair with fabric padded seat £220.00 £110.00 n/a n/a Farrington chair with leather seat (selection 1) £260.00 £130.00 n/a n/a Farrington chair with Saddle leather...
- 6
- 240
- 0
Bioavailability and toxicity of cd to microorganisms and their activities in soil
... field and laboratory studies; (iii) determine the relationship between Cd bioavailability and toxicity; and (iv) determine the factors that control Cd bioavailability and toxicity to soil microorganisms ... difficult In general, Cd shows more toxicity in sandy soils than in clay soils Soil solution Cd, and not the total concentration of Cd, seems to correlate well with ecotoxicity parameters No single ... decreased toxicity of Cd to several fungi in soil with an increasing content of montmorillonite Presence of different mineral nutrients, cations or anions in the soil can also alter the toxicity of Cd...
- 15
- 596
- 0
Báo cáo khoa học: Reduced FAS transcription in clones of U937 cells that have acquired resistance to Fas-induced apoptosis ppt
... growth in progressively increasing concentrations of stimulating Fas antibody [16] To investigate the molecular basis that underlies the resistance to Fas- induced apoptosis, the resistant cells ... 6G), indicating that increased phosphorylation of ERK1 ⁄ is not sufficient to mediate the resistance to Fas- induced apoptosis In conclusion, this suggests that the canonical MAP-kinase signalling ... the resistance to Fas- induced apoptosis in our system Survival signalling pathways downstream of Ras, such as the phosphoinositide 3-kinase (PI3-kinase) and the mitogen-activated protein kinase...
- 12
- 411
- 0
Từ khóa: find the maximum value of the function subject to the constraintfind the maximum value of the objective function subject to the constraintsfind the maximum value of the function subject to the following constraintswave flow regimes of a thin layer of viscous fluid subject to gravityi expected loss for exposures other than sl subject to theii expected loss for sl exposures subject to the supervisoi exposures subject to irb approachii portion of exposures subject to the standardised approadisclosures for portfolios subject to irb approimports subject to state trading and phase out schedulebinding legally enforceable decision arbitration is usually subject to specific laws which vary according to state and countrymoreover because omron is constantly striving to improve its high quality products the information contained in this manual is subject to change without notice every precaution has been taken in the preparation of this manual nevertheless omron assuuse your knowledge of the subject to decide whether the following statements are true or false write t or fwhat s the best subject to make a game about if you paid wages in a state that is subject to credit reductionBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ