Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 1
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 5
... heterogenicity of vtg gene family and expressions of multiple vtg genes were investigated using a model fish, the zebrafish (Danio rerio) The study of vtg genes provides valuable information for further ... Red tilapia (Oreochromis mossambica) was used to explore the potential of using Vtgs as DNA carriers for development of a novel method for producing transgenic fish Preliminary experiments showed ... investigation of the expression sites of vtg genes challenge the traditional belief that liver is the only organ for Vtg synthesis in oviparous vertebrates The preliminary studies on receptor- mediated gene...
- 4
- 137
- 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 4
... Receptor- mediated gene transfer 24 hr, DNA~Vtg-pLys 144 24 hr, DNA~Vtg-pLys 144 24 hr, DNA 24 hr, DNA 24 hr, DNA 48 hr, DNA~Vtg-pLys 144 48 hr, DNA~Vtg-pLys 144 48 hr, DNA 48 hr, DNA 60 55 % of total ... radioactivity % of recovered of whole fish 50 45 40 35 30 25 20 15 10 24 48 ovary 24 48 liver 24 48 gut 24 gill 48 24 48 heart 24 48 spleen 24 48 kidney 24 48 others remains Fig 4- 6 Relative radioactivities ... 211 nm was measured for each elute For modification of pLys 144 by SPDP at a molar ratio of pLys 144 to SPDP of 1:2, 30 µl of SPDP (20 nmol/µl) was mixed with 150 µl of pLys 144 (2 nmol/µl) and the...
- 47
- 230
- 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 3
... Chapter Expression of vtgs 3. 3 .3 Tissue localization of vtg mRNAs 3. 3 .3. 1 Expression of vtgs in the liver of female fish and E2 treated male fish 3. 3 .3. 1.1 Morphological observations of H&E stained ... of vtgs sizes of the amplified products were the same as estimated from vtg cDNA sequences, i.e., 1 73 bp for vtg1, 190 bp for vtg2 and 130 bp for vtg3 (Fig 3- 3B,D,F) 3. 3.2.1.2 Determination of ... 11 .3 Female E2 treated 636 .1 30 .0 9.6 1.1 1.0 3. 5 3. 0 9.7 Fold induction 5.4 4.4 -0.5 0.5 0.5 1.5 1.6 -0.1 Control 6.0 1.7 10.7 5.5 0.6 3. 6 1 .3 13. 7 Male E2 treated 731 .4 42.5 15.5 1.9 0.7 3. 2 3. 4...
- 52
- 272
- 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 2
... full-length cDNA sequences of vtg1-7 A8** A17 A 22 A30 A67 A80 A87 A119 A 126 A139 A183 A186 A1 92 A193 A 220 A 227 A248 A250 A2 52 A253 A256 A257 A259 A269 A2 72 A290 A295 A296 A300 A306 A3 42 A349 A368 A371 ... (24 0) 44% (28 8) 43% (23 5) 47% (24 7) 40% ( 325 ) 49% (22 2) 39% (316) 48% (26 5) 40% (20 8) 47% (25 9) 43% (24 9) 46% ( 328 ) 52% (20 0) 43% (20 5) 43% (21 8) 46% (25 2) 43% (24 4) 48% (21 6) 41% (25 6) 53% (21 7) ... 47% (24 4) 43% (318) 78% (22 2) 42% (318) 80% (26 1) 44% (20 6) 44% (25 6) 78% (24 4) 46% ( 323 ) 79% (20 0) 42% (20 7) 79% (21 8) 99% (25 3) 45% (24 4) 44% (21 7) 43% (25 6) 81% (22 1) 88% (28 9) 98% (26 5) 43%...
- 58
- 363
- 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 1
... Chapter General Introduction 1. 1 Oogenesis and vitellogenesis 1. 1 .1 Oogenesis The development of an egg is known as oogenesis, which can be divided into different phases including 1) proliferation of ... harness of this gene transfer method will rely on the improvements of its reproducibility and the foreign gene integration rate 18 Chapter General Introduction D Particle bombardment Gene transfer ... levels in the liver of teleost fish (Mommsen and Walsh, 19 88) 1. 2 Vitellogenin 1. 2 .1 Vitellogenin proteins The term vitellogenin was first used to refer to a serum form of a yolk protein precursor...
- 26
- 337
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... F, Matusova R, Danoun S, Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 18 9 19 4 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome ... Discussion Plant CCD1s are known to catalyze the cleavage of the C9–C10 and the C9¢–C10¢ double bonds of several carotenoids Recently, it was shown that these enzymes can also cleave at the C5–C6 and ... linear substrates is not unique to OsCCD1 Apart from the formation of geranial, the OsCCD1 cleavage reactions were identical to those of other plant CCD1s, as supported by the formation of pseudoionone,...
- 12
- 497
- 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
... human and a murine NICN1 cDNA clone from the IMAGE collection and determined the complete sequences of these cDNAs The comparative analysis of the human, canine, and murine NICN1 cDNA revealed a ... CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 bp) 600 … TTCGACgtgagtaacagtgtc 74 bp (exon 6, 14 31 bp) 20 31 … AATAAATACTTGTGGAATATG ... by the AMT gene for aminomethyltransferase, an enzyme of glycine metabolism [4 ,11 ] The promoters of the canine and murine NICN1 genes lack a TATA box-motif In both species, the sequences in the...
- 6
- 450
- 0
Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx
... strain to those of the other simian rotavirus strains, SA11 and RRV Materials and methods Rotavirus isolation The YK-1 strain of simian rotavirus was isolated from the diarrheal stool of a 2-year-old ... was based on a Jennerianapproach prompted by studies indicating that animal and human rotaviruses share a common group antigen and that experimental animals immunized with human strains of rotavirus ... Virology Journal 2006, 3:40 C11 and Ala strains in rabbits [5], and human rotaviruses with piglets [6] Two simian rotavirus strains, SA11 and RRV, have been well characterized and are currently...
- 8
- 530
- 0
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc
... 11 9 11 9 11 8 11 6 11 7 11 9 92 12 6 15 1 14 2 11 8 11 8 11 3 11 2 14 2 14 0 16 6 PFYQGHKN Figure The two coffee candidates for NDR1 protein belong to the NHL family Putative Arabidopsis orthologs of CaNDR1a/b ... Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 (a) CE (b) 12 0 Page 10 of 17 μ PM PMA2 86 NDR1 47 34 (c) (μg) 10 15 PM 26 soluble Figure The CaNDR1a protein is enriched in plasma ... enhanced disease resistance to the DC3000 strain, as previously reported Cacas et al BMC Plant Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 Page of 17 Figure The CaNDR1a protein...
- 17
- 455
- 0
Pathomechanistic characterization of DMT1 mediated manganese cytotoxicity implications in neurodegeneration
... expressed in almost every population of cells in the brain, these results indicate the importance of DMT1 in mediating iron transport in the brain In addition, as an example of DMT1 mutation in human, ... expression of DMT1 was also found in the astrocytic end feet, suggesting the involvement of DMT1 in iron uptake from the endothelial cells lining of the BBB (Wang, Ong et al 2001) Interestingly, ... basal ganglia of non-human primate also showed robust DMT1 staining The regions with extensive DMT1 staining were also co-observed with iron staining examined using Turnbull’s iron staining assay...
- 233
- 435
- 0
Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf
... chloroquine and monensin interfered with the ATP-dependent intraendosomal degradation of internalized radioactive CT [6] Recently, we have identified an endosomal aspartic acid protease, cathepsin D, ... action of cholera toxin and cathepsin D T El Hage et al min) increased two-fold in endosomes isolated from CT-injected rats (closed squares), but this was not observed for CT-B-injected (closed diamonds) ... CT action A B Role of endosomal acidification and cathepsin D in CT action Fig CT-mediated recruitment of ARF-6 and ADP-ribosylation of Gsa in hepatic endosomes (A) Rat liver endosomal (EN), plasma...
- 16
- 536
- 0
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc
... within )260/)119, we Ó FEBS 2002 Integrin a3 gene promoter (Eur J Biochem 269) 4529 Fig Effects of mutations in the Ets- and GATA-binding sites and the E-box of the mouse a3 integrin gene on promoter ... assay (EMSA) using the Ets consensus site at )133 As the involvement of the Ets consensus binding site at )133 in the promoter activity of the mouse a3 integrin gene was suggested by the luciferase ... regulation for the integrin a3 subunit is one of crucial issues to be resolved in cancer biology We previously reported the structures of the mouse a3 integrin subunit gene including the exon/intron...
- 9
- 562
- 0
Molecular characterization and developmental expression patterns of the zebrafish twist gene family
... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish twist genes Figure 3.8: Expression of zebrafish twist ... medaka, and human twist genes showed that the zebrafish twist1 a and twist1 b are coparalogs and co-orthologs of human TWIST1 Furthermore, zebrafish twist1 a and twist1 b are orthologous to medaka twist1 a...
- 115
- 260
- 0
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"
... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocytes suspended in PBS, and pravastatin-loaded ... Koitabashi Y, Kumai T, Matsumoto N, Watanabe M, Sekine S, Yanagida Y, Kobayashi S Orange juice increased the bioavailability of pravastatin, 3-hydroxy-3-methylglutaryl CoA reductase inhibitor, in...
- 9
- 829
- 0
Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing
... breakdown of lignocellulosic biomass for the establishment of a robust and cost-efficient process for production of cellulosic ethanol Acknowledgements Financial support by the Center for Bioprocessing ... thermophilic consortia for cellulase and xylanase production [7, 27] These reports, however, lack information on the biochemical and kinetic properties of the secreted enzymes Such information may be ... understanding of the lignocellulose biodegradation in relation to the enzyme system produced by the microbial community The focus of this work was on the characterization of cellulose- and xylan-degrading...
- 14
- 525
- 0
Từ khóa: c 1 physical characterization of the set up for an enantioselective synthesismethods for the purification and characterization of human adipose derived stem cellscharacterization of additives for source identification of refined productsand there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly diseasephysicochemical characterization of interfacescharacterization of the reservoir rockimplementing a characterization of genrehow to write a business plan for potential investorswriting a business plan for potential investorsarchitecture for the development of contextsensitive mobile applicationsinternational institute for sustainable development policy and diplomacy of sportmobilization of domestic resources for economic developmentrisk factors for the development of breast cancer includeimportance of quality management systems and standards for systems developmentmobilization of domestic and external resources for economic developmentBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ