... heterogenicity of vtg gene family and expressions of multiple vtg genes were investigated using a model fish, the zebrafish (Danio rerio) The study of vtg genes provides valuable information for further ... Red tilapia (Oreochromis mossambica) was used to explore the potential of using Vtgs as DNA carriers for development of a novel method for producing transgenic...
... Chapter Expression of vtgs 3. 3 .3 Tissue localization of vtg mRNAs 3. 3 .3. 1 Expression of vtgs in the liver of female fish and E2 treated male fish 3. 3 .3. 1.1 Morphological observations of H&E stained ... of vtgs sizes of the amplified products were the same as estimated from vtg cDNA sequences, i.e., 1 73 bp for vtg1, 190 bp for vtg2 and 130 bp for vtg3 (Fig 3-...
... Chapter General Introduction 1. 1 Oogenesis and vitellogenesis 1. 1 .1 Oogenesis The development of an egg is known as oogenesis, which can be divided into different phases including 1) proliferation of ... harness of this gene transfer method will rely on the improvements of its reproducibility and the foreign gene integration rate 18 Chapter General Introduction D Par...
... for recombinant and native GAPDH with a multit using a common value of Km and different values of kcat The estimated parameters had a value of 25 lM for the Km, and the kcat for recombinant and ... those of native GAPDH The decrease of the catalytic constant is a fast process compared to the decrease of the K0.5 for BPGA These changes are...
... abrogating peanut agglutinin binding Furthermore, the peanut agglutinin staining in the developing nervous system documented by D’Amico and Jacobs [8] could not be confirmed in our in situ hybridization ... suggesting that some of these inactive proteins may act like cosmc as chaperones for core-1 b3GalT However, the combined coexpression of active and inactive D melanogaster co...
... expressed in almost every population of cells in the brain, these results indicate the importance of DMT1 in mediating iron transport in the brain In addition, as an example of DMT1 mutation in human, ... expression of DMT1 was also found in the astrocytic end feet, suggesting the involvement of DMT1 in iron uptake from the endothelial cells lining of the B...
... chloroquine and monensin interfered with the ATP-dependent intraendosomal degradation of internalized radioactive CT [6] Recently, we have identified an endosomal aspartic acid protease, cathepsin D, ... action of cholera toxin and cathepsin D T El Hage et al min) increased two-fold in endosomes isolated from CT-injected rats (closed squares), but this was not observed f...
... within )260/)119, we Ó FEBS 2002 Integrin a3 gene promoter (Eur J Biochem 269) 4529 Fig Effects of mutations in the Ets- and GATA-binding sites and the E-box of the mouse a3 integrin gene on promoter ... assay (EMSA) using the Ets consensus site at )133 As the involvement of the Ets consensus binding site at )133 in the promoter activity of th...
... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish...
... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocyt...
... breakdown of lignocellulosic biomass for the establishment of a robust and cost-efficient process for production of cellulosic ethanol Acknowledgements Financial support by the Center for Bioprocessing ... thermophilic consortia for cellulase and xylanase production [7, 27] These reports, however, lack information on the biochemical and kinetic properties of the...
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...