0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Part development of novel methods for the synthesis of homoallylic alcohols part II multigrams synthesis of ( ) epibatidine

Part   development of novel methods for the synthesis of homoallylic alcohols part II  multigrams synthesis of ( ) epibatidine

Part development of novel methods for the synthesis of homoallylic alcohols part II multigrams synthesis of ( ) epibatidine

... 25 25 25 Time (h) 2.0 5.0 6.0 1.5 5.0 2.0 Yield %b (1 03:10 4) (E/Z)c 25 (1 00: 0) (8 0/2 0) 23 (1 00: 0) (8 0/2 0) 25 (7 6:2 4) (8 0/2 0) 45 (1 00: 0) (8 0/2 0) 49 (1 00: 0) (8 0/2 0) 69 (1 00: 0) (8 0/2 0) 105 105a 105b ... Yield 9a (% ) ( : ) (E/Z) 15 (7 5:2 5) (1 00/ 0) 22 (2 3:7 7) (8 0/2 0) 40 (9 9: 1) (8 2/1 8) 55 (1 00: 0) (8 0/2 0) 69 (1 00: 0) (8 0/2 0) OH 105f Yield 11f (% ) 13 28 23 10 The investigations on the effects of solvent ... Synthetic Route 183 iii SUMMARY PART I: Development of Novel Methods for the Synthesis of Homoallylic Alcohols In the development of novel methods for the synthesis of homoallylic alcohols, two conceptual...
  • 211
  • 497
  • 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / ... pattern of TiO2 nanotubes annealed under N2 atmosphere at 500 ◦ C given in Fig shows predominantly anatase TiO2 [9,22,23] DRUV–vis spectra of the as-anodized and annealed titania nanotubes are...
  • 8
  • 634
  • 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a sulfurous pollutant on the CaO NPs/ of 1:40 ... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials,...
  • 12
  • 705
  • 0
solvothermal reactions- an original route for the synthesis of novel materials

solvothermal reactions- an original route for the synthesis of novel materials

... synthesis of novel materials and the development of new processes Solvothermal synthesis of novel materials Roy has described the challenge for synthesizing new materials to specification [32] Hydro- and ... Conclusion Solvothermal reactions appear to be important for either the synthesis of novel materials, the preparation of nanostructured particles for nanotechnologies or the elaboration of bio-inspired ... properties of the selected solvent can also play an important role for orienting the structural form of the final material Lu et al [24] have underlined that the solvothermal synthesis of MnS can lead...
  • 11
  • 1,527
  • 0
Báo cáo y học:

Báo cáo y học: "Classification methods for the development of genomic signatures from high-dimensional data" potx

... evaluation of the performance of a classification algorithm The SN is the proportion of correct positive classifications out of the number of true positives The SP is the proportion of correct ... classifications out of the number of true negatives The accuracy is the total number of correct classifications out of the total number of samples The PPV is the probability that a patient is ... We define the prediction accuracy of the ensemble by majority voting as: Ar = P (Y ≥ k + 1) Accuracy of classification algorithms for the van de Vijver et al [17] data Figure Accuracy of classification...
  • 7
  • 454
  • 0
Analytical methods for the performance evaluation and improvement of multiple part type manufacturing systems

Analytical methods for the performance evaluation and improvement of multiple part type manufacturing systems

... topologies of manufacturing systems 2.2 Analytical methods for the performance evaluation of manufacturing systems There has been a plethora of literature on the analytical modeling of production systems ... objective of this thesis is to develop analytical methods to evaluate the performance of multiple part- type production systems The multiple part- type systems that have been studied in the literature ... that were developed for the analysis of single part- type manufacturing systems are first reviewed These methods were often the foundation for the analysis of multiple part- type systems Subsequently,...
  • 218
  • 351
  • 0
Development of NMR methods for the structural elucidation of large proteins

Development of NMR methods for the structural elucidation of large proteins

... DEVELOPMENT OF NMR METHODS FOR THE STRUCTURAL ELUCIDATION OF LARGE PROTEINS ZHENG YU (B.Sc., Xiamen University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL ... analysis of complex, x    Development of NMR methods for the structural elucidation of large proteins Summary   crowded and folded high-dimensional spectra On the basis of this software platform, ... 199 xii    Development of NMR methods for the structural elucidation of large proteins List of Figures   List of Figures  Figure 1.1: The flowchart of protein structure determination by NMR Figure...
  • 257
  • 289
  • 0
Development of new methodologies for the synthesis of enantiomerically enriched compounds

Development of new methodologies for the synthesis of enantiomerically enriched compounds

... DEVELOPMENT OF NEW METHODOLOGIES FOR THE SYNTHESIS OF ENANTIOMERICALLY ENRICHED COMPOUNDS LEE CHENG HSIA ANGELINE (B.ApplSc (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... alcohols, there are no reported illustrations for the synthesis of the cis-linear regioisomer Herein, an effective and unusual approach towards the synthesis of enantiomerically cis-linear homoallylic ... central role in the chemical, biological, pharmaceutical, and material sciences Preparation of enantiomerically pure compounds is essential for the advancement of these sciences Often, the biological...
  • 223
  • 272
  • 0
Development of computational methods for the rapid determination of NMR resonance assignment of large proteins

Development of computational methods for the rapid determination of NMR resonance assignment of large proteins

... determination is the spectral assignment procedure This involves sequence-specific resonance assignment of NMR signals and the assignment of NOESY spectra Resonance assignment forms the basis for characterizing ... obtain the assignments of the Cα and CO of the same residue Then, the CO frequency is used to obtain assignments for the HN and 15N of residue (i+1) with the HNCO experiment Finally, the NH and ... applications for solution NMR 1.3.2 TROSY triple -resonance experiments for resonance assignments of large proteins NMR experiments provide a set of unique combinations of neighboring resonance spin...
  • 90
  • 243
  • 0
Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge

Comparison of Methods for the Extraction of Bioflocculants from Activated Sludge

... an effort to develop an effective extraction method for bioflocculants from the microbial cell surface Materials and Methods Activated sludge samples Activated sludge samples were collected from ... was the most effective extraction method for activated sludge However, cell disruption is not effective for the isolation of bioflocculants Thus, NaOH extraction was the most effective method for ... polymer extraction methods (steaming extraction, NaOH extraction, SDS extraction, and washing extraction) were compared to develop an effective extraction method for bioflocculants from activated sludge...
  • 11
  • 695
  • 1
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Methods for the Qualitative Evaluation of Lexical Association Measures" doc

... qualitative evaluation of lexical association measures, mainly for the following reasons: the instability of precision values obtained from the rst few percent of the data in the SLs; the lack of signicant ... precision values above 50% for the rst 10% of the list, but is outperformed by the t-test afterwards Looking at the rst 40% of the data, there is a big gap between the good measures (t-test, ... identication of between 75% (AdjN) and 80% (PNV) of the TPs (ii) For the rst 40% of the SLs, and lead to the worst results, with outperforming 10% 20% 30% -test 40% 50% 60% 70% 80% 90% 100% part of signicance...
  • 8
  • 516
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ... Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase...
  • 11
  • 571
  • 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involved in the biosynthesis of SPA from A actinomycetemcomitans ... for synthesizing the SPAs in other serotypes of A actinomycetemcomitans The biosynthetic pathway for GDP-6-deoxy-D-talose, Ó FEBS 2002 GDP-6-deoxy-D-talose synthetic enzyme (Eur J Biochem 269)...
  • 9
  • 625
  • 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

... patterns of the ZnO sample synthesized at 120 ◦C for 17 h hydrothermal treatment Figure a b d e c f Fig SEM images of the time-dependent evolution in the formation of 3D flower-like ZnO synthesized ... of the formation process of the 3D flower-like ZnO Figure Fig (a) Bar graph illustration of the photocatalytic degradation of KGL using ZnO samples synthesized at 120 ◦C for different hydrothermal ... order to further study the effects of the hydrothermal treatment temperature on the ZnO product, samples were also synthesized at 90 ºC and 150 ºC for 17 h The morphologies of the ZnO samples...
  • 26
  • 551
  • 0
nmr methods for the investigation of structure and transport

nmr methods for the investigation of structure and transport

... number of spins By linearity of the Fourier transform the direct relation between the peak integral and the number of spins of the corresponding chemical group holds for the spectrum of superposed ... derivation due to the time-dependence of the unit vectors Using the product rule for the derivation and the fact that the time derivative of the unit vector is the cross product of !rf with this ... expressions Qn and MCk the naturals n and k signify the index of the result and measured data vectors, respectively The latter results from the discretization of e.g kx in (2.38) For the sake of completeness,...
  • 223
  • 786
  • 0

Xem thêm

Từ khóa: and there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly diseasethe discovery that micrornas mirnas are synthesized as hairpincontaining precursors and share many features has stimulated the development of several computational approaches for identifying new mirna genes in various animal speciesthe synthesis of the modified tetrapyrrole known asd1haem requires several dedicated proteins which are coded for by a set of genes that are often found adjacent to the structural genedevelopment of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestsarchitecture for the development of contextsensitive mobile applicationsthe development of the internal combustion engine was responsible foragreement on the co operation for the sustainable development of the mekong river basinagreement on the cooperation for the sustainable development of the mekong river basin 1995agreement on cooperation for the sustainable development of the mekong river basinrisk factors for the development of breast cancer includethe development of tamoxifen for breast cancer therapyaccount for the recent development in the financial sector of nigerian economyaccount for the recent development in the financial sector of nigeria economythesis improving the quality of retail banking services in bank for investment and development of vietnam hanoi branch southsome solutions for the development of consumer lending at techcombank hoang quoc vietNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam