Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 3
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 6
... rigid core exert hindrance to self- assembly whereas the pyrimidine groups stabilized the self- assembly of jacketed polymers A series of novel jacketed liquid crystalline polymers, in which the terphenyl ... expected to help the self- assembly of the polymers The length of the alkyl chain and position of the alkyl chain on the mesogenic units appears to have significant effect on the self- assembly Besides ... between rigid segments and flexible segments, polar or nonpolar effect is investigated through the incorporation of the polar functional groups A series of novel jacketed polymers were synthesized...
- 4
- 214
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 5
... of polymers 3a, 3b and 3c were measured in chloroform solution The absorption and emission spectra of the polymers are shown in Fig .5. 3 and the values as given in Table 5. 2 The UV spectrum of ... = 5. 2Hz, CCH(O)-, H), 4 .5 (d, J = 5. 5 Hz, O-CH2-, H), 2.7 (s, -OH, H) 13 CNMR ( 75. 4 MHz, CDCl3, δ ppm) 154 .2, 137.2, 134.7, 127.7, 126.7, 126.0, 1 25. 7, 1 25. 5, 121.0, 1 05. 3 (ArC), 69.4 (O-CH-), ... 300 400 50 0 wavelength (nm) Figure 5. 3 UV-vis absorption and Fluorescence spectra of polymers measured in chloroform at room temperature Table 5. 2 The detailed data of UV-vis absorption and Fluorescence...
- 19
- 314
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 4
... CDCl3, δ ppm): 171, 149 .80, 149 .45 , 141 .17, 137.08, 136.62, 135.76, 1 34. 62, 1 34. 49, 133.79, 130.59, 129.33, 128.88, 126.63, 1 24. 90, 1 24. 07, 123 .45 , 113.72, 77.33, 76.91, 76 .48 , 69.11, 31.79, 30.79, ... 2θ1/° 2θ2/° 2θ3/° 2 4/ ° 2θ5/° d1(Å) d2(Å) d3(Å) d4(Å) d5(Å) 2 .46 2.86 P1(DBSA)0.5 3.02 20.1 P1 4. 91 7 .42 19.8 35.9 30.6 29 .4 17.9 11.9 4. 5 4. 4 The XRD diffraction pattern of P1 shows sharp reflection ... formed via host polymers with pyrimidine groups and alkyl sulfonic acid and investigate their self- assembling properties in the solid state 1 14 4.2 Experimental section 4. 2.1 Materials and reagents...
- 26
- 504
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 3
... 4H), 3. 86 (s, Ar-O-CH3, 3H), 3. 78 (s, Ar-O-CH3, 3H), 3. 77 (s, Ar-O-CH3, 3H), 2.20 (b, -C-OH, 1H) 13 C NMR (75.4 MHz, CDCl3, δ ppm) 158.7, 151.2, 149.4, 131 .4, 130 .4, 129.7, 129 .3, 114.6, 1 13. 5, ... 150.4, 130 .4, 129.7, 129 .3, 128.9, 127.8, 118.0, 115 .3, 114 .3 (ArC), 69.6 (O-CH2-), 56 .3 (O-CH3), 31 .8, 29.5 (-CH2-), 13. 4 (-CH3) MS (EI): m/z: 474.4, 420 .3, 36 4 .3, 30 7.2, 247.1, 199 Mp: 1 23 °C ... Hz, -CH3, H) 13C NMR (75.4 MHz, CDCl3, δ ppm) 158 .3, 151.1, 149.68, 137 .4, 130 .6, 130 .5, 129.6, 129.5, 129.4, 129 .3, 128 .3, 127.5, 127.1, 118.5, 117.4, 115 .3, 115.1, 114 .3, 114.0, 1 13. 3, 1 13. 0 (ArC),...
- 31
- 521
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 2
... 131 .2, 124 .4, 122 .0, 117.5, 114.8, 106.4, 92. 4 (Ar-C), 68.8 (O-CH-), 31 .2, 28 .9, 28 .8, 28 .7, 28 .6, 28 .5, 28 .4, 25 .4, 21 .9 20 .2 (-CH2-), 13.8 (-CH3) MS (ESI): m/z: 434.3, 22 6.1, 23 8.1, 21 2.1, ... 131.5, 128 .6, 128 .2, 127 .2, 115.9, 114.6, 106 .2 (Ar-C), 71.7, 69.5 (O-CH-), 318, 29 .5, 29 .4, 29 .3, 29 .2, 29 .1, 29 .0, 25 .9, 22 .6 (-CH2-), 13.9 (-CH3) MS (ESI): m/z: 524 .5, 433.4, 355 .2, 26 5.1, 23 8.1, ... (C=O), 157.3, 156.7, 156 .2, 154 .2, 141.5, 134.8, 129 .1, 128 .2, 125 .2, 124 .8, 113.5 (ArC, C=C), 69.3 (O-CH-), 31.8, 29 .5, 29 .4, 29 .3, 29 .2, 29 .1, 28 .7, 27 .9, 25 .8, 22 .6 67 (-CH2-), 18.3 (=C-CH3), 13.9...
- 25
- 298
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application
... enhanced in the selfassembly of the novel polymers 53 2.1.4 Conclusion A series of novel jacketed polymers were synthesized, and characterized using GPC, DSC, TGA, FTIR, NMR, and X-ray diffraction ... properties of jacketed polymers in which the main chain is sterically crowded with laterally attached rigid side chains17-19 Here we report the synthesis of a series of novel jacketed polymers ... interactions, and shape effects, to control the self- assembly of polymer chains in the lattice The novel polymers were characterized with GPC, DSC, TGA, FTIR, 35 and NMR This work show characterization...
- 24
- 324
- 0
Fabrication and characterization of semiconductor nanowires for thermoelectric application 3
... 3/ (#CpD), $ = L2/(%2&) and & = k/(#Cp) Equation (3. 3) should be satisfied for the thermal conductivity calculated to be within +/ -3. 5% of the actual value < 2'$ < (3. 3) The parameters of the lock-in ... working frequency for the Ge nanowire sample was 1000 Hz, 0. 03 s of time constant was sufficient for stability 3. 11 Ceramic heater setup for temperature dependence characterization of thermal conductivity ... hydrofluoric acid/hydrogen peroxide (HF/H2O2) solution for chemical etching 3. 3 Ge nanowire growth The process chosen for Ge nanowire growth is VLS as discussed in section 2 .3. 1.1 Growth of GeNWs...
- 24
- 207
- 0
synthesis and application of functionalized diene-based polymers(fileminimizer)
... substitution of poly(4-fluoro-2,5benzophenone) with various nucleophiles .7 1-4 Synthesis of functionalized polythiophenes 1-5 Synthesis of functionalized PLA and PCL 1-6 Synthesis ... 1-6 Synthesis of functional polyesters In the following chapters, the functionalized monomer approach is used to prepare functionalized diene-based materials Synthesis of a wide variety of functionalized ... Scheme 1-4 Synthesis of functionalized polythiophenes15 Nadeau et al reported the synthesis of functionalized poly(lactic acid)s (PLA) and poly(caprolactone)s (PCL) for biomedical applications...
- 184
- 332
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1) ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b...
- 12
- 588
- 0
Synthesis and Application of Nanosize Semiconductors for Photoxidation of Toxic Organic Chemicals pptx
... Adsorption of toxic chemicals in aqueous supernatant from Step 2)Chemical Oxidation or Total Mineralization of the the Organics 3)Deep UV Photooxidation of the Organics 4)Photocatalytic oxidation of ... in both dispersed and heterogeneous forms (supported) tsnl Advantanges of this Approach•The light absorption and energy levels of the semiconductor valence and conduction bands can be adjusted ... photostability and low toxicity can be selected (e.g MoS2) •Our synthesis allows easy chemical modification of the nanocluster surface properties (e.g deposition of a metal) •Small size of nanocluster...
- 22
- 961
- 0
synthesis and application of dna-templated silver nanowires
... of the adsorption sites gradually on the nanowires 3.2.2 Response and recovery of the DNA-templated silver nanowires exposed to ammonia The response and recovery of the DNA-templated silver nanowires ... carried out at room temperature Results and discussions 3.1 Fabrication of the DNA-templated silver nanowires The fabrication of DNA-templated silver nanowires was based on electroless plating, ... of DNA-templated silver nanowires, (b) shows enlargement of the DNA-Ag nanowires Fig Conductivity variation of the DNA-templated nanowires exposed to different concentrations of ammonia at room...
- 5
- 566
- 0
Nanoscale metal-organic frameworks synthesis and application of bimodal micromeso-structure and nanocrystals with controlled size and shape
... preparing bimodal micro- and meso-porous MOF nanocrystals, uniform nanosized MOFs with controlled- shape and size and subsequently, the extensive application of the prepared nanosized MOFs The first objective ... preparation of mesoporous MOF nanocrystals and uniform nanoscale MOFs with desired shape and size 1.2 Objectives of the thesis The aim of this thesis is to develop synthetic methods for preparing bimodal ... developed to achieve bimodal micro/mesoporous MOF nanocrystals as well as nanosized MOFs with controlled size and shape In addition, using the synthesized MOF nanocrystals as templates, a new hollow...
- 199
- 994
- 0
Expressed sequence tags analysis of major allergens producing dust mites and molecular characterization of their allergens
... www.pdffactory.com List of Tables IgE binding rates of the cloned dust mite allergens and their biological properties 22 Overview of the productions of recombinant mite allergens: from the aspects of the production ... mutants of the mites FABP homologues 70 Overview of the characteristics and statistical data of the dust mites EST collections 80 Summary and comparisons of gene expression levels in D farinae and ... House dust mites as an important cause of allergy 1.6.1 General aspects of mites Mites are normal inhabitants in our environment and are abundant in house dust as well as barns and grain stores Mites...
- 312
- 4,031
- 0
Study of the associated proteins of STAT3 and characterization of their functions roles of GRIM 19 and PIN1 in the regulation of STAT3 activity
... STUDY OF THE ASSOCIATED PROTEINS OF STAT3 AND CHARACTERIZATION OF THEIR FUNCTIONS: ROLES OF GRIM- 19 AND PIN1 IN THE REGULATION OF STAT3 ACTIVITY LUFEI CHENGCHEN B Sc (Hons), NUS A THESIS ... fold of human Pin1 37 Figure 3.1 Interaction of Stat3 and GRIM- 19 71 Figure 3.2 Association of endogenous Stat3 and GRIM- 19 75 Figure 3.3 Lack of interaction between GRIM- 19 and other STAT proteins ... GRIM- 19 in mitochondria 33 1.8.3 GRIM- 19 interacting proteins 34 1.9 Peptidyl-prolyl isomerase Pin1 1.9.1 Isolation and activity characterization of Pin1 1.10 Biological functions of Pin1 1.10.1 Pin1...
- 181
- 438
- 0
Synthesis and application of hydrous cerium oxide modified activated carbon for arsenic and lead removal
... SYNTHESIS AND APPLICATION OF HYDROUS CERIUM OXIDE MODIFIED ACTIVATED CARBON FOR ARSENIC AND LEAD REMOVAL ZHANG CHENGYU (B.Eng., Peking University) A THESIS SUBMITTED FOR THE DEGREE OF MASTER ... of raw particle activated carbon (left) and nanosized hydrous cerium oxide modified activated carbon (HCO-AC) 4.2.2 Preliminary test of synthesized materials The experimental data of HCO-AC and ... As(III) removal 4.2.1 Morphological study of material by SEM Figure 4.1 showed the SEM images of raw particle activated carbon and 21 nanosized hydrous cerium oxide modified activated carbon The...
- 69
- 332
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ