Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 4
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 6
... rigid core exert hindrance to self- assembly whereas the pyrimidine groups stabilized the self- assembly of jacketed polymers A series of novel jacketed liquid crystalline polymers, in which the terphenyl ... expected to help the self- assembly of the polymers The length of the alkyl chain and position of the alkyl chain on the mesogenic units appears to have s...
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 5
... of polymers 3a, 3b and 3c were measured in chloroform solution The absorption and emission spectra of the polymers are shown in Fig .5. 3 and the values as given in Table 5. 2 The UV spectrum of ... = 5. 2Hz, CCH(O)-, H), 4 .5 (d, J = 5. 5 Hz, O-CH2-, H), 2.7 (s, -OH, H) 13 CNMR ( 75. 4 MHz, CDCl3, δ ppm) 154 .2, 137.2, 134.7, 127.7, 126.7, 126.0, 1 25. 7, 1 25. 5, 121.0,...
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 4
... CDCl3, δ ppm): 171, 149 .80, 149 .45 , 141 .17, 137.08, 136.62, 135.76, 1 34. 62, 1 34. 49, 133.79, 130.59, 129.33, 128.88, 126.63, 1 24. 90, 1 24. 07, 123 .45 , 113.72, 77.33, 76.91, 76 .48 , 69.11, 31.79, 30.79, ... 2θ1/° 2θ2/° 2θ3/° 2 4/ ° 2θ5/° d1(Å) d2(Å) d3(Å) d4(Å) d5(Å) 2 .46 2.86 P1(DBSA)0.5 3.02 20.1 P1 4. 91 7 .42 19.8 35.9 30.6 29 .4 17.9 11.9 4. 5 4. 4 The XRD diffraction pat...
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 3
... 4H), 3. 86 (s, Ar-O-CH3, 3H), 3. 78 (s, Ar-O-CH3, 3H), 3. 77 (s, Ar-O-CH3, 3H), 2.20 (b, -C-OH, 1H) 13 C NMR (75.4 MHz, CDCl3, δ ppm) 158.7, 151.2, 149.4, 131 .4, 130 .4, 129.7, 129 .3, 114.6, 1 13. 5, ... 150.4, 130 .4, 129.7, 129 .3, 128.9, 127.8, 118.0, 115 .3, 114 .3 (ArC), 69.6 (O-CH2-), 56 .3 (O-CH3), 31 .8, 29.5 (-CH2-), 13. 4 (-CH3) MS (EI): m/z: 474.4, 420 .3, 36 4 .3, 30 7....
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 2
... 131 .2, 124 .4, 122 .0, 117.5, 114.8, 106.4, 92. 4 (Ar-C), 68.8 (O-CH-), 31 .2, 28 .9, 28 .8, 28 .7, 28 .6, 28 .5, 28 .4, 25 .4, 21 .9 20 .2 (-CH2-), 13.8 (-CH3) MS (ESI): m/z: 434.3, 22 6.1, 23 8.1, 21 2.1, ... 131.5, 128 .6, 128 .2, 127 .2, 115.9, 114.6, 106 .2 (Ar-C), 71.7, 69.5 (O-CH-), 318, 29 .5, 29 .4, 29 .3, 29 .2, 29 .1, 29 .0, 25 .9, 22 .6 (-CH2-), 13.9 (-CH3)...
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application
... enhanced in the selfassembly of the novel polymers 53 2.1.4 Conclusion A series of novel jacketed polymers were synthesized, and characterized using GPC, DSC, TGA, FTIR, NMR, and X-ray diffraction ... properties of jacketed polymers in which the main chain is sterically crowded with laterally attached rigid side chains17-19 Here we report the synthesis of a series...
Fabrication and characterization of semiconductor nanowires for thermoelectric application 4
... roughness of the nanowires and act as a form of phonon-scattering elements at several length scales If precipitates are incorporated carefully, the k of Ge Thermal Conductivity of GeNw and SiNw 77 nanowires ... resistivity of the GeNw were measured and extracted accordingly as below Electrode to 2, to and to : 0. 349 ! m Electrode to and to : 0 .41 3 ! m Electrode to :...
synthesis and application of functionalized diene-based polymers(fileminimizer)
... substitution of poly(4-fluoro-2,5benzophenone) with various nucleophiles .7 1-4 Synthesis of functionalized polythiophenes 1-5 Synthesis of functionalized PLA and PCL 1-6 Synthesis ... 1-6 Synthesis of functional polyesters In the following chapters, the functionalized monomer approach is used to prepare functionalized diene-based materials Synthesis of a wide...
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...
Synthesis and Application of Nanosize Semiconductors for Photoxidation of Toxic Organic Chemicals pptx
... Adsorption of toxic chemicals in aqueous supernatant from Step 2)Chemical Oxidation or Total Mineralization of the the Organics 3)Deep UV Photooxidation of the Organics 4)Photocatalytic oxidation of ... in both dispersed and heterogeneous forms (supported) tsnl Advantanges of this Approach•The light absorption and energy levels of the semiconductor valence and conduction...
synthesis and application of dna-templated silver nanowires
... of the adsorption sites gradually on the nanowires 3.2.2 Response and recovery of the DNA-templated silver nanowires exposed to ammonia The response and recovery of the DNA-templated silver nanowires ... carried out at room temperature Results and discussions 3.1 Fabrication of the DNA-templated silver nanowires The fabrication of DNA-templated silver...
Báo cáo khóa học: Overexpression and enzymatic characterization of Neisseria gonorrhoeae penicillin-binding protein 4 ppt
... range of 4. 27.5 and the male urethra having a pH of 6.28 .4 The pH dependence of NG PBP (pKa values of 6.9 and 10.1) therefore overlaps the alkaline side of the physiological growth range of N gonorrhoeae ... and characterization of the ponA gene encoding penicillin-binding protein from Neisseria gonorrhoeae and Neisseria meningitidis J Bacteriol 179, 27...
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx
... simulations on the divider can be performed The crystal oscillator is normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ ... measured and simulated phase noise for the 3.2-3.3 GHz band The square dots are the simulated data synthesizer phase noise performance The model can serve as a design guide...
Nanoscale metal-organic frameworks synthesis and application of bimodal micromeso-structure and nanocrystals with controlled size and shape
... preparing bimodal micro- and meso-porous MOF nanocrystals, uniform nanosized MOFs with controlled- shape and size and subsequently, the extensive application of the prepared nanosized MOFs The first objective ... preparation of mesoporous MOF nanocrystals and uniform nanoscale MOFs with desired shape and size 1.2 Objectives of the thesis The aim of this...
Expressed sequence tags analysis of major allergens producing dust mites and molecular characterization of their allergens
... www.pdffactory.com List of Tables IgE binding rates of the cloned dust mite allergens and their biological properties 22 Overview of the productions of recombinant mite allergens: from the aspects of the production ... mutants of the mites FABP homologues 70 Overview of the characteristics and statistical data of the dust mites EST collections 80 Summary and...
Từ khóa:
- studies on growth crystal structure and characterization of novel organic nicotinium trifluoroa
- testing and spectrometric characterization of polymers
- synthesis solubilisation and characterization of cdse zns core shell qds
- identification detection and molecular characterization of novel monopartite begomoviruses
- identification and characterization of der f 22 a novel allergen from dermatophagoides farinae a paralogue of der f 2
- synthesis and electrochemical performance of lifepo4 by solgel method
- synthesis and electrochemical performance of graphenepolyaniline
- synthesis and electrochemical performance of graphenelike ws2
- nanoparticle an overview of preparation characterization and application
- ecosystems and human wellbeing health synthesis a report of the millennium ecosystem assessment
- isolation and characterization of vascular endothelial cells from murine heart and lung
- isolation and characterization of embryonic and adult epicardium and epicardium derived cells
- 2measurement synthesis and materialization of manufacturing information
- electron energy loss spectroscopy and its applications to characterization of carbon materials
- electrochemical characterization of carbons and carbon alloys
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Chuong 2 nhận dạng rui ro
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật