Computational media aesthetics for media synthesis

... Summary of The Dissertation 7.1.1 Aesthetics for Single Image 7.1.2 Aesthetics for Multiple Images 7.1.3 Aesthetics for Videos 7.1.4 Aesthetics for Online Advertising 7.2 Conclusions ... deﬁnition, applied media aesthetics is diﬀerent in several aspects 1.2 Methodology of Applied Media Aesthetics • Applied media aesthetics does not try to answer the eternal question for aesthetics - ... two aspects of computational media aesthetics The former one aims to evaluate the aesthetic level of a given media piece and the latter aims to produce media outputs based on computational aesthetic...

Where Does Computational Media Aesthetics Fit? docx

... full expressiveness MM References C Dorai and S Venkatesh, Computational Media Aesthetics: Finding Meaning Beautiful,” IEEE MultiMedia, vol 8, no 4, Oct.–Dec 2001, pp 10-12 26 R Zhao and W.I ... consistency, repeatability, and robustness Final thoughts IEEE MultiMedia What does the CMA philosophy bring to this situation? Does systematic attention to domain distinctives, such as ﬁlm grammar, ... appropriate structure? What does it mean? Does a strata (a shot-based contextual description) properly belong to ﬁlm, or is it a secondary term more suited to user-defined film media assessment? As...

modeling the prosody of vietnamese language for speech synthesis

... this thesis is to model the characteristics of Vietnamese prosody for speech synthesis It focuses on the influences of the macro -prosody on the micro -prosody, in three types of sentence: assertive, ... characteristics of Vietnamese prosody to generate the prosody description” for speech synthesis In this thesis, we just focus on the differences of Vietnamese tones in different positions in the sentence ... "naturalness" of synthesized speech is depends on ability of macro -prosody controlling during speech synthesis process Objectives and Tasks This thesis is part of MICA speech synthesis research...

Tài liệu Information, secrets, and enigmas: an enfolding-unfolding aesthetics for cinema pptx

... assistant; to Ian Buchanan and his colleagues and students at the University of Cardiff; and to Richard Coccia and the Coccia family 98 Screen 50:1 Spring 2009 Laura U Marks Information, secrets, ... weep and sleep; Dreymann plays music on the piano; he and Sieland make love and gently touch each other It is ﬁlmed in warm tones that emphasize the perceptual richness of this life and the meaning ... and not others.19 What I call images and information are symptoms of a ﬂow of forces.20 A Nietzschean approach helps us to understand the nature of the forces that unfold and enfold these planes...

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ... Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase...

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-speciﬁc polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involved in the biosynthesis of SPA from A actinomycetemcomitans ... for synthesizing the SPAs in other serotypes of A actinomycetemcomitans The biosynthetic pathway for GDP-6-deoxy-D-talose, Ó FEBS 2002 GDP-6-deoxy-D-talose synthetic enzyme (Eur J Biochem 269)...

solvothermal reactions- an original route for the synthesis of novel materials

... synthesis of novel materials and the development of new processes Solvothermal synthesis of novel materials Roy has described the challenge for synthesizing new materials to speciﬁcation [32] Hydro- and ... Conclusion Solvothermal reactions appear to be important for either the synthesis of novel materials, the preparation of nanostructured particles for nanotechnologies or the elaboration of bio-inspired ... properties of the selected solvent can also play an important role for orienting the structural form of the ﬁnal material Lu et al [24] have underlined that the solvothermal synthesis of MnS can lead...

11
1,527
0

Adapting Models of Visual Aesthetics for Personalized Content Creation potx

... methodology for the generation of personalized computational models of visual aesthetics (and content which is driven by those models) in the literature As this methodology builds upon the adaptation of ... the visual properties being evaluated and the process of adapting an aesthetic model to player choices Section V presents results of ofﬂine (non-interactive) optimization of a sample of visual ... representation aids visual identiﬁcation of the generated content as spaceships, allowing for a better visualization to players adapting their aesthetic model based on the selection of such content Finally,...

Báo cáo khoa học: "Decomposition and Stress Assignment for Speech Synthesis" pdf

... to Speech, incomplete draft, undergroland press, 1979 Chomsky, N., and Halle, M., The Sound Pattern of English, Harper and Row, 1968 Church, K., Stress Assignment in Letter to Sound Rules for Speech ... support the the stress neutral theory because they never receive main stress But, they can also be accounted for under the compound theory because they form nouns, and therefore the main stress would ... (almost) never take the main stress However, un- can also be accounted for under the compound theory by noting that un- forms adjectives and verbs, and therefore main stress would fall on the right...

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / ... pattern of TiO2 nanotubes annealed under N2 atmosphere at 500 ◦ C given in Fig shows predominantly anatase TiO2 [9,22,23] DRUV–vis spectra of the as-anodized and annealed titania nanotubes are...

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a sulfurous pollutant on the CaO NPs/ of 1:40 ... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials,...

solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

... patterns of the ZnO sample synthesized at 120 ◦C for 17 h hydrothermal treatment Figure a b d e c f Fig SEM images of the time-dependent evolution in the formation of 3D flower-like ZnO synthesized ... of the formation process of the 3D flower-like ZnO Figure Fig (a) Bar graph illustration of the photocatalytic degradation of KGL using ZnO samples synthesized at 120 ◦C for different hydrothermal ... order to further study the effects of the hydrothermal treatment temperature on the ZnO product, samples were also synthesized at 90 ºC and 150 ºC for 17 h The morphologies of the ZnO samples...

functional thin films and nanostructures for sensors. synthesis, physics, and applications

... Zribi • Jeffrey Fortin Editors Functional Thin Films and Nanostructures for Sensors Synthesis, Physics, and Applications Editors Anis Zribi United Technologies Corporation Fire and Security Kidde ... design considerations related to the use of functional thin films and nanostructures, and specific case studies of functional thin films and nanostructure applications in sensing Part of our motivation ... functional thin films and functional nanostructures Thin films and nanostructures play an increasingly important role in state-of-the-art sensors and actuator technologies both as transducers (functional...

Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

... Surface area of the catalyst before and after use in the reaction was measured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments) All the chemicals were used as-received ... [6], amines [7], and synthesis of azaheterocycles [8] are some of the synthetic applications of oximes They are also useful for selective a- activation [9] and are extensively used as intermediates ... method for the preparation of oximes The methodology also offers chemical, economical, and environmental advantages On the other hand, Bi2O3 is remarkably easier to use, nonhazardous, inexpensive and...

Xem thêm

Từ khóa: robust unit selection system for speech synthesis alternative pathways for et synthesis an original route for the synthesis of novel materials specific features of supercritical water for hydrothermal synthesis water in co2 microemulsions for materials synthesis zeolites as catalysts for ether synthesis heteropolyacids as catalysts for mtbe synthesis commericial processes for ether synthesis tools for the synthesis of drug like molecule libraries computational fluid dynamics for the assessment of cerebrospinal fluid flow and its coupling with cerebral blood flow other techniques for hydrogel synthesis logic difference optimization for incremental synthesis model based analysis tools for component synthesis selected recipes for the synthesis of high silica zeolites general procedure used for the synthesis of high silica zeolites Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ