0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Structural and functional studies on type III and type VI secretion system proteins

Structural and functional studies on type III and type VI secretion system proteins

Structural and functional studies on type III and type VI secretion system proteins

... I Secretion System 1.6 Type II Secretion System 10 1.7 Type III Secretion System 12 1.8 Type IV Secretion System 26 1.9 Type V Secretion System 27 1.10 Type VI Secretion System 29 1.11 Aim of ... Island Figure: Type I–V secretion systems in Gram-negative bacteria Figure: 1.3 Model of pilus-mediated secretion via the type II secretion system 11 Figure: 1.4 The Type Three Secretion System ... abbreviations xvi Publications xx Chapter 1: General Introduction 1.1 Host Pathogen Interaction 1.2 Pathogenicity islands 1.3 Protein Secretion System 1.4 Sec system 1.5 Type I Secretion System...
  • 169
  • 356
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
  • 10
  • 553
  • 0
Functional studies of a type III and a novel secretion system of edwardsiella tarda

Functional studies of a type III and a novel secretion system of edwardsiella tarda

... such as Escherichia coli, Salmonella, Shigella, and Yersinia species E tarda is a relatively new genus, and the first report about the genus of Edwardsiella was in Japan by Sakazaki and Murata (1962) ... bromo-4-chloro-3-indolyl-β-D-galactopyranoside xv SUMMARY Edwardsiella tarda is an opportunistic gram-negative bacterial pathogen affecting both animals and humans The ability of E tarda to cause disease is dependent ... humans and cause diseases in humans Association of E tarda with human diseases was first reported in 1969 (Jordan and Hadley, 1969) So far, at least 300 clinical cases have been reported E tarda...
  • 205
  • 618
  • 0
Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

... FUNCTIONAL STUDIES ON SULPHATION STATUS OF HEPARAN SULPHATE IN BREAST NON- TUMOURIGENIC EPITHELIAL AND CANCER CELLS GUO CHUNHUA (B.Med., M.Med.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Undersulphation of GAGs inhibited invasion of breast cancer cell in vitro 120 Discussion 123 HSPG and breast cancer growth 123 HSPG and adhesion, migration and invasion in ... Reduction in heparan sulphation in breast cancer cells was demonstrated to inhibit breast cancer cell proliferation The inhibitory effect could be rescued by addition of porcine intestine mucosa-derived...
  • 289
  • 366
  • 0
Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx

Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx

... DNA-editing enzyme) in host target cells, which resulted in the accumulation of mutations in the tumour suppressor protein TP53 Type IV secretion in H pylori pathogenesis [22] Thus, the induction of ... to in uence the pathogenesis of H pylori There are two classical secreted virulence factors present in H pylori: the vacuolating cytotoxin (VacA) and the CagA protein encoded by the cytotoxin-associated ... phenotype also involves tyrosine dephosphorylation of cortactin, vinculin and ezrin, which are three wellknown actin-binding proteins [6] The phosphatases involved in this scenario, however, remain...
  • 13
  • 866
  • 0
Báo cáo khoa học: Architecture of the Helicobacter pylori Cag-type IV secretion system pdf

Báo cáo khoa học: Architecture of the Helicobacter pylori Cag-type IV secretion system pdf

... tip of the pilus Cag proteins in the T4SS apparatus is not clear, although several of them are essential for the secretion of CagA or the induction of interleukin-8 [23] The NTPases battery of the ... proteins Other components are essential for the formation of the T4SS complex: VirB1 allows for the insertion of the system in the periplasm and VirB3, the function of which is unknown, is often ... bacteria, some of these components are absent This is the case for the H pylori ComB system where the apparatus is used to import DNA at the outer membrane and relies on the other competence system ComEC...
  • 10
  • 367
  • 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB1 WhiB2 WhiB2 WhiB2 WhiB2 WhiB5 WhiB5 WhiB5 WhiB5 ... 90 90 75 60 60 45 30 30 15 WhiB1 WhiB2 WhiB3 WhiB4 WhiB5 WhiB6 WhiB7 D 0h 2h 6h 20 h 30 h 42 h Effect of GSH (10 mM) WhiB1 WhiB2 WhiB3 WhiB4 WhiB5 WhiB6 WhiB7 Effect of GSSG (10 mM) % Change in...
  • 18
  • 548
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... 6A,B) In the present study, we compared the functional roles of the N- and C-terminal regions of 4482 H Tanaka et al molluskan and vertebrate TnI and revealed for the first time that (a) the alternative ... of the troponin complex In molluskan muscles, the C-terminal region does not function and troponin regulates contraction only through the activation exerted by the N-terminal region of TnI Experimental ... amount of nonspecific precipitation of the TnI-fragment was also monitored by simultaneous centrifugation of the sample containing no actin-tropomyosin under the same conditions Reconstitution of...
  • 12
  • 514
  • 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... loop, the first and last turns of helices E and F, and the C-terminus helices I and J In addition, there is a lysine-rich N- and C-terminus, in accordance with the basic isoelectric point of CagS ... as that of other members of this family Finally, when crystallized in the presence of Cu(II), the protein shows the presence of the ion coordinated in a small cavity of the surface at the polar ... strand of a second monomer, allowing for the formation of the dimer The surface of interaction between monomers also involves portion of chains D and E of the two monomers, which are held together...
  • 9
  • 496
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and LPS-II (well 2) of C braakii PCM 1531, and LPS of Citrobacter ... inhibition of passive haemagglutination, SDS/ PAGE and immunoblotting using O-antisera against C braakii PCM 1531 and PCM 1487 In double immunodiffusion (Fig 4), the LPS of C braakii PCM 1531 and PCM...
  • 7
  • 478
  • 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on ... staining when CaCl2 is added to the staining and washing buffer (Fig 1) Measurement of antifreeze activity Antifreeze activity was measured on equimolar amounts of deglycosylated and untreated...
  • 8
  • 518
  • 0
Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot

Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot

... In immunotype 1, the outer core has at least one O-acetylation site and the O-acetyl group is present in the core of a minority of the LPS molecules The position of the O-acetyl groups in the core ... all of the data together, the structures of the core and core with one O-polysaccharide repeating unit in the LPS of P aeruginosa immunotype were established (Fig 7) DISCUSSION Previously, the ... remainder by ESI MS and NMR spectroscopy enabled determination of not only the biological repeating unit but also of the mode and the site of the linkage between the O-polysaccharide and the core It...
  • 10
  • 470
  • 0

Xem thêm

Từ khóa: functional studies on monolaris proteinoryzae avrxa21 activity is dependent on a type one secretion systemgel forming and cell associated mucins preparation for structural and functional studiesreview of studies on nutritional status and educationepidemiological studies on antioxidants and cardiovascular diseasedependent on type degree and severity of the injuryribosomes from trypanosomatids unique structural and functional propertiesstudies on growth crystal structure and characterization of novel organic nicotinium trifluoroastructural and functional roles of fsh and lh as glycoproteins regulating reproduction in mammalstructural and functional insightscase studies on hiv and diabetes surveillancediverse domains of cytosine 5 dna methyltransferases structural and functional characterizati in the late 1820s and 30s d d stull and m j broadway slaughterhouse blues the meat and poultry industry in north america case studies on contemporary social issues belmont ca wadsworth publishing 2003 34structural and functional aspects of viroporins in human respiratory viruses respiratory syncytsynthesis spectral magnetic thermal and antimicrobial studies on symmetrically substituted 2Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ