Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 5

... discussed in the following sections 8.4 Synthesis of Ge nanocrystals in U-shape groove In order to minimize the shadowing effect and make a relatively conformal film deposition, the KOH etching process ... bottom of the groove (i.e 70.6°) as comparing to the one of the corner of the mesa (i.e 144.7°) This difference in the arriving angle will inevitably cause the shadowing effect and results in the ... enhanced when the annealing temperature exceeds the melting point of Ge (i.e 937°C) By creating the U-shape groove substrate and hence increasing the Si/silicon oxide interfaces, one enables...

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 1

... 4 .10 : XTEM image of Sample B annealed at 10 00°C in forming gas (10 % H2 + 90% N2) for 15 minutes Figure 4 .11 : XTEM image of Sample C annealed at 800°C in forming gas (10 % H2 + 90% N2) for 15 minutes ... image of Sample A annealed at 800°C in forming gas (10 % H2 + 90% N2) for 15 minutes Figure 4.3: XTEM image of Sample A annealed at 900°C in forming gas (10 % H2 + 90% N2) for 15 minutes The inset ... between 800°C to 10 00°C for 15 minutes in forming gas (10 % H2 + 90% N2) Figure 4.7: Raman spectra of Sample C annealed between 800°C to 10 00°C for 15 minutes in forming gas (10 % H2 + 90% N2)...

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 2

... comparison of the growth of Ge nanocrystals in silicon oxide and HfAlO matrices - 1 02 - Chapter 5 .2 Results & Discussions II Ge nanocrystals in HfAlO matrix In order to synthesize the Ge nanocrystals in ... almost insoluble in silicon oxide [20 ,21 ], whereas it has been found that thermal processing of HfO + Ge systems can lead to the formation of hafnium germinate (HfGeOx) [22 ,23 ] The formation of the ... 20 04 [ 12] Q C Zhang, N Wu, L K Bera, and C X Zhu, “Study of Germanium Out-Diffusion in HfO2 Gate Dielectric of MOS Device on Germanium Substrate”, Mater Res Soc Symp Proc., vol 829 , pp 449, 20 04...

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 3

... annealed for 15 inset is the typical Raman spectra of as-grown and Ge nanocrystals nanocrystals of annealing minutes The free standing As mentioned in Section 4 .3, Figures 4.8 and 4.11 show that, ... a tensile stress will result in an increase in the lattice spacing and, hence, a decrease in the wavenumber of the vibrational mode In the case of compressive stress, the decrease of the lattice ... annealing time was increased from 15 to 60 minutes As such, the nanocrystals would grow and increase in number as the annealing duration increases, which causes an increase in P shown in Figure 6.5...

Synthesis and stress analysis of germanium nanocrystals embedded in dielectric matrices 4

... competing factors which will influence the stress state of the nanocrystals in dielectrics, one is the capping effect and the other is temperature-dependent intrinsic tensile strain of SiN film ... atoms and therefore the growth of the nanocrystals In addition, it is interesting to note from the inset of Figure 7.1 (e), unlike the nanocrystals of the RTA sample shown in the inset of Figure ... hence resulting in a build-up and increase in stress On the other hand, a furnace annealing at 800°C for 15 minutes allows the growth of the nanocrystals due to its longer annealing time This...

Báo cáo hóa học: " Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for third generation photovoltaics" doc

... nanocrystalline silicon embedded in SiO2 matrix Appl Phys Lett 1999, 75:1857-1859 Ding L, Chen TP, Liu Y, Ng CY, Fung S: Optical properties of silicon nanocrystals embedded in a SiO2 matrix Phys ... doi:10.1186/1556-276X-6-612 Cite this article as: Di et al.: Optical characterisation of silicon nanocrystals embedded in SiO2/Si3N4 hybrid matrix for third generation photovoltaics Nanoscale Research Letters ... larger grains A close-up view of region is shown in Figure 4a It is interesting to note that the intentionally doped Si NC films are more optically absorbing than the undoped material in this photon...

Báo cáo nghiên cứu nông nghiệp " Design and implementation and scientific and financial analysis of 12 Sunflower trials in Vietnam " pot

... crop season Sunflower was grown in the Autumn and compared to the financial benefit of maize in Di Linh district, Lam Dong province Crop Table 27 Economic analysis of sunflower, maize, in Autumn ... Study of the financial return of sunflower compared to maize and cotton in the South Central Coast of Viet Nam 2.3.1 Vegetative growth and development of sunflower hybrids Table 11 Yield and ancillary ... Profitability of sunflower production in Viet Nam March 2006 access unused nitrogen stored deep in the soil profile and benefit the following rice crop by reducing the incidence of pests, diseases and...

báo cáo khoa học: " Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes" docx

... stress and target genes were predicted for five of them For instance, vun_cand030 was downregulated by drought and putatively targets a zinc finger protein Zinc finger proteins are known to be involved ... breeding line developed by the International Institute of Tropical Page of 11 Agriculture (IITA) in Ibadan, Nigeria We grew these two genotypes in well-watered and drought stress conditions and ... identified in cowpea Detailed information of the predicted cowpea miRNAs and their targets Additional file 2: Predicted hairpin structures of nine genotypespecific miRNAs Predicted structures of nine...

Báo cáo y học: " A systematic review and meta-analysis of neurological soft signs in relatives of people with schizophrenia" ppsx

... Cite this article as: Neelam et al.: A systematic review and meta-analysis of neurological soft signs in relatives of people with schizophrenia BMC Psychiatry 2011 11:139 Submit your next manuscript ... Janssen J, Diaz-Caneja A, Reig S, Bombin I, Mayoral M, Parellada M, Graell M, Moreno D, Zabala A, Vazquez VG, Desco M, Arango C: Brain morphology and neurological soft signs in adolescents with ... their siblings the result of perinatal trauma? Acta Psychiatrica Scandinavica 2000, 101:142-147 32 Orwin RG: A fail-safe N for effect size in meta-analysis Journal of Educational Statistics 1983,...

báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling of the labelling kinetics ... SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3 Proc Natl Acad Sci USA 2002, 99:8436-8441 Mahajan S, Pandey G, Tuteja N: Calcium and Salt Stress Signaling in Plants:...

Báo cáo y học: "Genome-wide expression profiling and bioinformatics analysis of diurnally regulated genes in the mouse prefrontal cortex" pps

... expression analysis for diurnally regulated genes To gain insights into the tissue specificity of expression levels of diurnally regulated genes, we next examined their expression levels in the ... studies By identifying a large number of diurnally regulated genes in a defined brain region, a clustering analysis resulted in sufficiently large number of genes in each temporal category There ... R247 Yang et al R247.3 Figure A karyotype map showing the chromosome positions and frequencies of diurnally regulated genes in the mouse genome A karyotype map showing the chromosome positions and...

Synthesis and biological investigation of pyrimido 1,2 a 1,3,5 triazine and its analogues 2

... Methionine aminopeptidase Translation, ribosomal structure and biogenesis 2ea2, 1boa, 2gg8, 2p98, 2g6p 2. 948 0.58 62 43 1-aminocyclopropane-1carboxylate deaminase Amino acid transport and metabolism ... hepatocyte growth factor activity 3f 82, 3cd8 2. 956 0 .27 23 Branched-chain-amino-acid aminotransferase, mitochondrial Amino acid transport and metabolism 1kta, 1kt8 2. 94 0 .26 24 Renin Renin is a ... Met- and Leu-enkephalins by cleavage of a Gly-Phe bond 1r1i, 1y8j 3 .29 8 0.3548 3.644 0 .22 58 17 20 21 Amino acid transport and metabolism 22 DNA polymerase I, thermostable Replication, recombination...

Synthesis and biological investigation of pyrimido,1,2 a ,1,3,5,triazine and its analogues 1

... derivatives Anti-fungal activity was stated for derivatives 10 1a against Microsporum canis and average affinity of 10 1b for serotoninergic 5-HT 1A and 5-HT2B receptors was also published by Lucry and ... cyclocondensation of biguanide and its analogues 13 2 with ethyl acetoacetate gave 12 8 -13 1 as reported by Curd and Rose92 (Scheme 39, Method A) There was a need to develop an alternative method of obtaining ... catalyzed cyclization of potassium N,N-dicyanobenzamidine 11 2 with methyl anthranilate 11 1 in methanol gave triazino[2 ,1- b]quinazolone 11 4 instead of triazino [1, 2 -a] quinazolone 11 4’ In order to confirm...

Structural and functional analysis of critical proteins involved in mRNA decay

... STRUCTURAL AND FUNCTIONAL ANALYSIS OF CRITICAL PROTEINS INVOLVED IN mRNA DECAY CHENG ZHIHONG (B.Sc) Ease China University of Science and Technology A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... deadenylation, decapping and degradation of the mRNA body Three proteins, hUpf1, Dhh1 and Ski8 involved in eukaryotic mRNA decay were structurally and functionally studied in this thesis Ski8 ... include the poly(A)-binding protein (Pab1) and the cap-binding protein (eIF4E) Pab1 couples decapping with deadenylation and inhibits decapping by promoting the formation of the translation initiation...

báo cáo khoa học: " Haplotyping, linkage mapping and expression analysis of barley genes regulated by terminal drought stress influencing seed quality" pot

... Cite this article as: Worch et al.: Haplotyping, linkage mapping and expression analysis of barley genes regulated by terminal drought stress influencing seed quality BMC Plant Biology 2011 11:1 ... 4d drought (M) Palea_ 4d drought (M) Awn_ 4d drought (M) Seed_ 4d drought (M) Seed 20DAF _drought (Brenda) Seed 20DAF _drought (Hs584) Seedling _drought (OWB-D) Seedling _drought_ OWB-R) 21day seedling_38%SWC ... growth under drought stress A -3.0 B Palea_ 4d drought (M) Awn_ 4d drought (M) Seed_ 4d drought (M) Seed 20DAF _drought (B) Seed 20DAF _drought (Hs) 1:1 21day seedling_19%SWC (M) 21day seedling_7%SWC...

Xem thêm

Từ khóa: synthesis and electrochemical performance of lifepo4 by solgel method synthesis and electrochemical performance of graphenepolyaniline synthesis and electrochemical performance of graphenelike ws2 a syntactic and semantic analysis of turkish nominal compounds a syntactic semantic and pragmatic analysis of conjunction structural and chemical analysis of materials subjectivity and sentiment analysis of arabic a survey subjectivity and sentiment analysis of modern standard arabic difference between syntactic and semantic analysis of nlp cash flow statement and ratio analysis of tata motors an analysis of directive speech acts in the movie the sleeping and beauty structural and chemical analysis of materials pdf speech act theory and the analysis of conversations structural and stress analysis the aim theory and the analysis of the electron density Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ