0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

... FUNCTIONAL STUDIES ON SULPHATION STATUS OF HEPARAN SULPHATE IN BREAST NON- TUMOURIGENIC EPITHELIAL AND CANCER CELLS GUO CHUNHUA (B.Med., M.Med.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Undersulphation of GAGs inhibited invasion of breast cancer cell in vitro 120 Discussion 123 HSPG and breast cancer growth 123 HSPG and adhesion, migration and invasion in ... Reduction in heparan sulphation in breast cancer cells was demonstrated to inhibit breast cancer cell proliferation The inhibitory effect could be rescued by addition of porcine intestine mucosa-derived...
  • 289
  • 366
  • 0
báo cáo hóa học:

báo cáo hóa học:" A cross-sectional study of health-related quality of life deficits in individuals with comorbid diabetes and cancer" potx

... diabetes and cancer and the diabetes groups A significantly larger proportion of patients reported being inactive and having less than a secondary education in the comorbid diabetes and cancer and ... Canadian Diabetes Association, the Heart and Stroke Foundation of Canada, The Kidney Foundation of Canada, theCIHR – Institute of Nutrition, Metabolism and Diabetes and the CIHR – Institute of ... Circulatory and Respiratory Health SLB has studentship funding from the Canadian Diabetes Association and the Alberta Heritage Foundation for Medical Research JAJ is a Health Scholar with AHFMR and...
  • 9
  • 412
  • 0
Báo cáo y học:

Báo cáo y học: " Proteasome-independent degradation of HIV-1 in naturally non-permissive human placental trophoblast cells" pptx

... immunodeficiency virus type in human placental trophoblasts Journal of Virology 2004, 78:11904-11915 Vidricaire G, Tremblay MJ: A clathrin, caveolae, and dynaminindependent endocytic pathway requiring free ... immunodeficiency virus type J Gen Virol 1991, 72(Pt 6):1253-1260 Vidricaire G, Imbeault M, Tremblay MJ: Endocytic host cell machinery plays a dominant role in intracellular trafficking of incoming human ... involved in HIV-1 infection and restriction of placental trophoblast cells remains of utmost importance to the understanding of the natural mechanisms of control of in uteroHIV-1 motherto-child infection...
  • 9
  • 358
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
  • 10
  • 553
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

... processing approach to comprehension of French, w i l l form the basis of the discussion I t is the in interaction of the results of these asynchronous processes that the process of comprehension ... at any moment of the process are context dependent; they depend on the "current state" of the system The system presents an i n i t i a l attempt to integrate AI and brain theory, BT, on two levels, ... recognition comprehension and automatic translation into French One issue, how to chunk French into a phonetic representation of words, along with the implications of the determined representation...
  • 5
  • 609
  • 0
Case Studies on the Effectiveness of State Financial Incentives for Renewable Energy pdf

Case Studies on the Effectiveness of State Financial Incentives for Renewable Energy pdf

... regions of the state On the other hand, only a small fraction of those claiming the tax credit take advantage of the low-interest loan Furthermore, the property-tax exemption complements the ... National Laboratory, Matthew Brown of the National Conference of State Legislatures, Jane Weissman of the Interstate Renewable Energy Council, Frederick Beck of the Renewable Energy Policy Project, ... given the purpose and scope of this project—and the variety of factors influencing decisions toward the purchase of renewable energy systems—we use the term effectiveness in the context of the...
  • 128
  • 577
  • 0
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

... co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R1–YFP – genetic variant of dopamine D2 receptor) d Measured in cell co-expressing dopamine D1 and D2 fusion protein (D1 CFP and D2R2–YFP ... two dopamine D2 receptor fusion proteins (D2 CFP and D2 YFP) f Measured in cell co-expressing two dopamine D2 receptor fusion proteins (D2 CFP and D2R3–YFP – genetic variant of dopamine D2 receptor) ... of dopamine D2 receptor) e Measured in cell co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R3–YFP – genetic variant of dopamine D2 receptor) f Measured in cell co-expressing dopamine...
  • 16
  • 567
  • 0
Functional Health Status of the Elderly in Taiwan docx

Functional Health Status of the Elderly in Taiwan docx

... 2020–2025.22 The growing of the aging ­ opulation Healthy Aging & Clinical Care in the Elderly 2010:2 Functional health status of the elderly in Taiwan will require equivalent increase in health care ... measurable indicators that reflect all levels of their daily functioning The tool used in the Healthy Aging & Clinical Care in the Elderly 2010:2 Functional health status of the elderly in Taiwan ... Journal of Health and Health Care in Later Life 1990;35–54 Healthy Aging & Clinical Care in the Elderly 2010:2 Functional health status of the elderly in Taiwan Chi I, Chou KL, et al “Use of the Minimum...
  • 9
  • 401
  • 0
Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf

Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf

... above, these initial conditions were rapidly conducive to steady conditions where and were present in very similar concentrations, and the rates of the forward reaction (conversion of to 3) and the ... Discussion The main part of the present study was a search, under conditions of maximal stringency, for fragment exchange that could be the hallmark of the hypothetical retroaldol–aldol mechanism The ... 4-phosphate [28] The reductive reaction step has been shown to involve the transfer of a hydride ion from the pro-S position at C-4 of NADPH to the RE position of C-1 of reaction intermediate...
  • 14
  • 534
  • 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

... compilation ª 2009 FEBS 2101 Interaction of EW29Ch with sugars H Hemmi et al constants by NMR to analyze the interaction between the protein and lactose in a solution state As mentioned above, one of ... affect the dissociation constants By contrast, because chemical-shift changes upon the addition of sugars at subdomain c were in the fast exchange regime, Kd values describing the interaction of ... dissociation constants determined by NMR The site-specific binding constants and chemical exchange regimes of EW29Ch with sugars used in this study are given Table Upon the addition of sugars, the chemical-shift...
  • 11
  • 458
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Studies on larval parasitoids of Paranthrene tabaniformis (Rott.) (Lepidoptera: Sesiidae) on urban poplars (Populus spp.) in Sofia, Bulgaria" ppt

... populations in Europe [17, 20] It is bivoltine [23]; in this study its overwintering generation was associated with P tabaniformis Parasitoids of P tabaniformis in Sofia During the years of investigation, ... investigation, parasitoids destroyed a significant portion (32.5–55.6%) of overwintering larvae of P tabaniformis in Sofia No studies have been conducted on the parasitoids during the summer months, ... might increase of the sustainability of the poplar stands In urban areas in Sofia the parasitoids are obviously important biological component in reducing the number of P tabaniformis Some of them...
  • 6
  • 262
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "In vitro studies on the modification of low-dose hyper-radiosensitivity in prostate cancer cells by incubation with genistein and estradiol" pot

... during genistein incubation and the incubation with higher genistein doses Mechanisms of interaction To search for mechanisms of interaction we investigated protein expression of cell cycle controlling ... with genistein 10 μM and irradiation with Gy together, the effects of genistein on survival in these cell lines seem to be independent of ER- and p53-expression In contrast, low concentrations of ... after incubation with genistein concentrations of 15 – 30 μM in FCS-containing media [41] In this study the NF-κB activity was investigated, too An inhibition of radiationinduced activation of NF-κB...
  • 12
  • 368
  • 0
báo cáo khoa học:

báo cáo khoa học: "Studies on dairy production of milking ewes I. - Estimates of genetic parameters for total milk composition and yield " pptx

... first on- farm estimation of genetic parameters for dairy traits (milk yield and composition) in milking ewes The present estimates were generally consistent with those obtained in dairy cows for ... variabilities of fat and protein matter and for genetic correlations between matter yields and milk yield, between milk yield and both contents, between fat yield and content However, the genetic correlation ... choice On the one hand, the low level of milk production with a high concentration necessitated the fast development of a selection scheme On the other hand, recording the milk concentration on the...
  • 16
  • 193
  • 0

Xem thêm

Từ khóa: review of studies on nutritional status and educationreview ten empirical studies on the impact of inflation on economic growth in nigeriaten empirical studies on the impact of inflation on economic growth in nigeriacase studies on the economics of regulating agricultural biotechnologyexperimental studies on the survival of pathogens in frozen foodsresearch on the importance of body language in communicationon the nature of joint strength in paperon the role of emotional intelligence in second language learningcomment on the role of chinese language in international communicationstatus of tourism industry in the philippinesglobalization and its effects on the development of educational service in vietnamon the use of indicator variables in regression analysishiện trạng chăn nuôi ở việt nam current status of livestock production in vietnam§ 10 non recognition and the european community declaration on the guidelines on the recognition of new states in eastern europe and in the soviet unionstatus of legislative activity in each stateBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam