Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives
Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives
... culture feeding 3.2.3 Human embryonic stem cells and induced pluripotent stem cells Human embryonic stem cell line HES-3 (46, XX) was from ES Cell International (Singapore, http://www.escellinternational.com) ... forebrain, midbrain, hindbrain and the spinal cord This figure was reproduced from Epstein et al., 1999 2.4 SHH and neural development During the initial ph...
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem...
Establishment of autologous culture systems for human embryonic stem cells
... sources, named embryonic stem cells Literature review (ESCs), embryonic germ cells, fetal stem cells, umbilical cord stem cells, adult stem cells and induced pluripotent stem (iPS) cells (Ariff ... cell source for future clinical applications Literature review Table Characterization of stem cells by derivation source Category Embryonic stem cells Embryoni...
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28
... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCAC...
Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf
... adult stem cells is their inability to effectively grow in Human embryonic stem cells and therapeutic cloning culture Therefore, obtaining clinically significant amounts of adult stem cells may ... and characterization of human embryonic stem cells Stem Cells Dev 2004, 13, 325-336 18 Drukker M, Benvenisty N The immunogenicity of human embryonic stem- derived...
Determining the role of sonic hedgehog in establishing midbrain dopaminergic neuron subclasses
... progression in the progenitors and reduces the generation of MbDNs in vMb Interestingly, further insights into the role of Wnt1/β-catenin pathway revealed that it is also required to maintain the integrity ... changes in the concentration or the duration of Shh have an effect on intracellular signaling in the spinal cord 23 Aim of the study Aim of the the...
báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx
... transplanted vascular cells derived from human ES cells and the vascular density in the infarct area after the transplantation In the saline- and hMNCs-injected groups, the vascular density of host ... characterization of transplanted cells derived from human ES cells We induced differentiation of human ES cells in an in vitro two-dimensional cu...
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
... family, the miR-200 family have been reported in human [16,17] and mouse embryonic stem cells [18-20] The unique patterns of miRNA expression in embryonic stem cells suggest they are involved in maintaining ... instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[ 73] Another me...
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 1
... specification of midbrain dopamine neurons Radial glia cells are neuronal progenitors in vivo 10 11 14 1. 3 Long non- coding RNAs in biology 15 1. 3 .1 1.3.2 1. 3.2 .1 1.3.2.2 1. 3.2.3 Long non- coding RNAs in pluripotency ... pluripotency, and repressing differentiation simultaneously 18 1. 3.2 Long non- coding RNAs in neural developmen...
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 3
... chr 13: 36 ,31 5,670 -36 ,31 7,9 83 chr4:1,179,572-1,181,6 03 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 AK124684 AK125262 AK12 539 2 AL 832 189 AY927 532 BC008027 BC 030 122 BC 031 955 ... location (NCBI36/hg18) AF242771 AK05 533 5 AK056826 (lncRNA_ES1) AK0911 13 AL117559 AL 833 138 BC02 630 0 (lncRNA_ES3) chr12: 63, 376, 238 - 63, 376,597 chr19: 43,...
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 4
... was confirmed by qPCR in two independent cell lines: hESC (H1)-derived NPCs and an immortalized human neural stem cell line ReN-VM In both hESC-derived cells and ReN-VM cells, RMST expression ... silencing factor, is a transcription factor expressed in neural stem cells and non- neuronal cells, to repress neuronal gene expression To confirm that REST indeed binds up...
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5
... established in the mouse model system, and very few human lncRNAs have been studied with such extent In this thesis, I focused on examining lncRNAs involved in the pluripotency maintenance of human embryonic ... B., Liu, M., and Shi, T (2011) Comparative analysis of human protein -coding and noncoding RNAs between brain and 10 mixed cell lines by RNA-Seq PLoS...
IN VIVO EX VIVO OSTEOGENESIS OF HUMAN EMBRYONIC STEM CELLS
... staining (c) hFOB H & E staining (d) hFOB von Kossa staining Scaffold (e) hFOB H & E staining Figure At 2-week time point: H&E staining and von Kossa staining of sections showing scaffold and cells ... time point: H&E staining and von Kossa staining of sections showing scaffolds devoid of cells 43 Figure At week time-point: (a) H&E staining showing newly formed tissue within the ......
Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"
... JM Embryonic stem cell lines derived from human blastocysts Science 1998;282(5391):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from human blastocysts: ... Germany) with an HBO-103 mercury lamp and filter sets for FITC, Cy3.5, Texas Red, Cy5, Aqua, and DAPI Images were captured, processed, and analyzed using ISIS mBAND/mFISH imaging softwar...
Từ khóa:
- human embryonic stem cells from laboratory and clinical perspectives
- embryonic stem cells and cardiac progenitors sources of cardiomyocytes
- development of the coronary arteries in the embryonic human heart
- the role of positive facial feedback in the stress response
- the role of data link layer in osi model
- the role of capital markets authority in kenya
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Phát hiện xâm nhập dựa trên thuật toán k means
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Chuong 2 nhận dạng rui ro
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)