Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons
Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons 2
... 0.057 0. 128 0 .21 8 0.3 32 0.437 0.549 0.6 72 0.855 0.981 1.1 62 1.358 1.5 72 1.780 1.981 2. 2 02 2.4 12 0.0 12 0. 022 0.034 0.045 0.055 0.063 0.0 72 0.0 82 0.089 0.097 0.105 0.113 0. 120 0. 126 0.1 32 0.137 ... 0.143 0 .24 2 0.343 0.443 0.550 0.699 0.838 0.997 1 .20 5 1.401 1.601 1.799 2. 008 2. 207 2. 406 0.010 0. 022 0.0 32 0.041 0.049 0.057 0.066 0.074 0.0 82 0.091 0.099 0.106 0.1 12 0.118 0. 123 0. 128 Temperature=55 ... Temperature=45 ºC 0.0 62 0.157 0 .26 1 0.354 0.4 52 0.561 0.694 0.845 1.001 1 .20 6 1.414 1.6 02 1.804 2. 038 2. 230 2. 394 0.006 0.014 0. 021 0. 027 0.0 32 0.038 0.044 0.051 0.057 0.065 0.0 72 0.078 0.083 0.090...
- 13
- 194
- 0
Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons
... EXPERIMENTAL AND THEORETICAL STUDIES ON ADSORBED NATURAL GAS STORAGE SYSTEM USING ACTIVATED CARBONS KAZI AFZALUR RAHMAN (B.Sc in Mechanical Engineering, ... Saha, W.G Chun, K.C Ng, Theoretical modeling and simulation for adsorbed natural gas storage system using activated carbon, Proceedings of the 9th International Conference on Sustainable Energy ... operations due to the adsorption and desorption processes In this research, the ANG storage system is comprehensively studied both experimentally and theoretically for enhanced storage capacity and...
- 209
- 290
- 0
Experimental and theoretical studies on adsorption chillers driven by waste heat and propane
... Introduction 1.1 Background 1.1.1 Heat Sorption Systems and Global Concerns on the Environment and Ecology 1.1.2 Limitations of Adsorption Chillers 1.1.3 Propane ... Choon Ng, and Wongee Chun "Pressurized Adsorption Cooling Cycles Driven by Solar /Waste Heat. " Applied Thermal Engineering (2014) Li, Ang, Ismail, Azhar Bin, Kyaw Thu, Kim Choon Ng, and Wai Soong ... saturation region for common working temperatures of evaporator and condenser Introduction 1.1.4 Review of Previous Studies on Adsorption Pairs In the literature, there have been extensive studies...
- 294
- 282
- 0
Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps
... infection by inhibition of IFN signaling and blocking of the antiviral response [17] In this study we analyzed two variants of mumps virus V protein (VWT and VGly) derived from Urabe AM9 vaccine ... position 156 in the V protein (VGly) of HN-G1081 virus variant, whereas resistance to IFN was associated with preservation of wild-type phenotype in the V protein (VWT) of HN-A1081 Virus variant In the ... study we experimentally tested the interaction of VWT and VGly proteins of Urabe AM9 mumps virus variants with proteins of the IFN signaling pathway, finding differences in their capacity to...
- 10
- 311
- 0
Experimental and theoretical studies of waste heat driven pressurized adsorption chillers
... Figure 5.40 Temperature profiles of major components of the waste- heat driven pressurized adsorption chiller with input heat flux of 2.75 W cm-2 147 Figure 5.41 Effects of operation time on chiller ... variation of the heat of adsorption as a function of loading, which in turn depends on the pressure and temperature at which adsorption/ desorption occurs The heat of adsorption, Qst can be measured experimentally ... Figure 5.13 Isosteric heat of adsorption for Maxsorb III-R507a 124 Figure 5.14 Isosteric heat of adsorption for ACF A20-R134a 124 Figure 5.15 Isosteric heat of adsorption for ACF A20-R507a...
- 221
- 830
- 0
Experimental and numerical studies on the viscoelastic behavior of living cells
... Literature review 17 contribution of the cell membrane and spectrin network to the large deformation of red cells On the other hand, the continuum modeling approach treats the cell as a continuum material ... EXPERIMENTAL AND NUMERICAL STUDIES ON THE VISCOELASTIC BEHAVIOR OF LIVING CELLS ZHOU ENHUA (B.Eng., WUHEE & M.Eng., WHU) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... that the experimental methodology and theoretical model put forward in this thesis will contribute to a more accurate evaluation of the viscoelastic properties of cells and better understanding of...
- 191
- 275
- 0
Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides
... semiconductor -based all- optical switches include semiconductor optical amplifier (SOA) and more recently silicon photonics Implementation of ultrafast silicon photonic switch is largely based on ... principles and switching operations of EUPT and EDPT 2.1.1 Energy-up photonic transistor based on AMOI scheme The all- optical operation of EUPT adopts the Absorption Manipulation of Optical Interference ... of transitions between optical and electrical domains, i.e Optical- toElectrical (OE) and Electrical-to -Optical (EO) or OEO conversions, which poses a lot of power consumption, space occupation,...
- 234
- 504
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc
... Crystal structure of E53QbsSHMT and its complexes Table Data collection statistics of E53QbsSHMT and its complexes Values in parantheses correspond to highest resolution bin Ligand(s) used None Gly ... belonged to the P21212 space group and contained one monomer in the asymmetric unit Cell dimensions and details of data collection are shown in Table Expression and purification of bsSHMT and E53QbsSHMT ... the enzyme conformation previously exposed to glycine and FTHF is different from that before exposure and that E53QbsSHMT exhibits enzyme memory The slow conformational change seen in the E53QbsSHMT...
- 13
- 514
- 0
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... described in Materials and methods H2O2 evokes a decrease and an increase in the intracellular concentration of ATP and inosine, respectively Searching for the rationale for these phenomena, possible ... degradation and the appearance of intermediate products were essentially the same in both cases and, above all, no appreciable differences in the rates of disappearance of ATP or appearance of Ino ... the main if not unique source of inosine is the intracellular pool of adenine nucleotides, (b) the decrease in ATP and the increase in inosine, promoted by H2O2, cannot be explained solely by a...
- 12
- 506
- 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and LPS-II (well 2) of C braakii PCM 1531, and LPS of Citrobacter ... inhibition of passive haemagglutination, SDS/ PAGE and immunoblotting using O-antisera against C braakii PCM 1531 and PCM 1487 In double immunodiffusion (Fig 4), the LPS of C braakii PCM 1531 and PCM...
- 7
- 478
- 0
Combustion and emission characteristics of a natural gas fueled diesel engine with EGR
... of engine parameters on performance and emissions of a pilot ignited natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and ... A2 T þ A3 T þ A4 T þ Þ ð5Þ [16] Mbarawa M, Milton BE, Casey RT Experiments and modeling of natural gas Cp ¼ð where (A0 ), (A1 ), (A2 ), (A3 ), and (A4 ) are constants, and their values are [28]: A0 ... work aims at investigating the effect of utilization of partly-cooled EGR on the combustion process and exhaust emission characteristics of a pilot ignited natural gas diesel engine A comparative...
- 12
- 573
- 0
Báo cáo toán học: "Antioxidant, antimicrobial, and theoretical studies of the thiosemicarbazone derivative Schiff base 2-(2-imino-1-methylimidazolidin-4-ylidene)hydrazinecarbothioamide (IMHC)" potx
... Antioxidant, antimicrobial, and theoretical studies of the thiosemicarbazone derivative Schiff base 2-(2-imino-1-methylimidazolidin-4- ylidene)hydrazinecarbothioamide ... across the C=N bond The existence of the thione form predominantly in the solid state is demonstrated by the presence of two absorption bands at 1273.7 and 3421 cm−1 belonging to the C=S and NH ... Optimized 3D structure of the IMHC Figure The effect of test organism toward synthesized compound Figure The effect of tested fungi toward synthesized compound Figure The effect of synthesized compound...
- 23
- 449
- 1
Từ khóa: cytokines and inflammatoryrecruitment in nash experimental and human studiesexperimental and clinical studiessynthesis spectral magnetic thermal and antimicrobial studies on symmetrically substituted 2calculate the pseudo critical temperature and pressure for the following natural gas stream compositionexperimental and analytical studies of surface generation in evcexperimental and theoretical techniquesrussian oil and natural gas exportsrussia oil and natural gas exportsmethanol production from biomass and natural gasus oil and natural gas exportsoil and natural gas transportation storage infrastructurereview of studies on nutritional status and educationepidemiological studies on antioxidants and cardiovascular diseasesources of physical and valuation data on natural resources and the environmentstudies on growth crystal structure and characterization of novel organic nicotinium trifluoroaBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ