0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

A middle cerebral artery occlusion modelling study of combinatorial treatment (acute phase) and post ischemic exercise (chronic phase) in rats

A middle cerebral artery occlusion modelling study of combinatorial treatment (acute phase) and post ischemic exercise (chronic phase) in rats

A middle cerebral artery occlusion modelling study of combinatorial treatment (acute phase) and post ischemic exercise (chronic phase) in rats

... A MIDDLE CEREBRAL ARTERY OCCLUSION MODELLING STUDY OF COMBINATORIAL TREATMENT (ACUTE PHASE) AND POST- ISCHEMIC EXERCISE (CHRONIC PHASE) IN RATS ELGIN YAP EE LIN (B Sc (Merits), NUS) A THESIS ... in rats with combined inhibitors treatment Fig (a) Intracellular ATP level following single and combined inhibitors administration of pan-caspase inhibitor (z-VAD-fmk) and PARP inhibitor (3-AB) ... appreciation to Prof Bay Boon Huat (Department of Anatomy, NUS), Prof Ling Eng Ang (Department of Anatomy, NUS) and A/ P Samuel Tay Sam Wah (Department of Anatomy, NUS) for their valuable aid and...
  • 271
  • 233
  • 0
báo cáo hóa học:

báo cáo hóa học: " Effects of the cyclooxygenase-2 inhibitor nimesulide on cerebral infarction and neurological deficits induced by permanent middle cerebral artery occlusion in the rat" potx

... efficacy on the cerebral infarction induced by permanent middle cerebral artery occlusion (pMCAO) in the rat, a clinically relevant model of ischemic stroke The effects of the COX-2 inhibitor nimesulide ... development of focal cerebral infarction induced by permanent middle cerebral artery occlusion (pMCAO) Figure Temporal development of focal cerebral infarction induced by permanent middle cerebral artery ... permanent model of stroke induced by the occlusion of the middle cerebral artery using an intraluminal suture, the infarct size progresses very fast in the subcortical areas (mainly striatum) and much...
  • 11
  • 568
  • 0
báo cáo hóa học:

báo cáo hóa học: " Parecoxib is neuroprotective in spontaneously hypertensive rats after transient middle cerebral artery occlusion: a divided treatment response?" docx

... TGAGATACGTGTTGACGTCC CTCTTCTCATTCCTGCTCGT CATAAGCCAACAAGTGGTATTCTC CAGGGAGATCTTGGAAATGAG TGACGGTCAGGTCATCACTATC TGAGTACTTCTCGGATGAAGG TTCCTTATTTCCTTTCACACCC GAGAAGATGATCTGAGTGTGAG TGTTTGGGATCCACACTCTC GGCAAATTTCCTGGTTATATCC ... Following weighing and shaving, the animals were placed in supine position on a heating pad and allowed to breathe spontaneously through a facemask Isoflurane was decreased to 1.0– 1.5% and administered ... area Day 2.0 * 1.5 1.0 0.5 0.0 Cortex Subcortical area Day Cortex Subcortical area Day Figure ADC values and ratios on Day and Day after tMCAo ADC values and ratios on Day and Day after tMCAo 3A...
  • 19
  • 397
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Canine model of ischemic stroke with permanent middle cerebral artery occlusion: clinical and histopathological findings" docx

... implemented a canine model of permanent embolic stroke Models of cerebral ischemia can Necropsy, TTC staining, and histopathology Atrophic and necrotic lesions were observed on the ventral surface of the ... left lateral ventricle and thalamus by mass effect were identified in all images Canine permanent MCAO model of ischemic stroke 373 Imaging analysis On the estimation of the percent lesion volume, ... (1 g/kg body weight, constant rate of IV infusion for 30 min) was also continued for the next 1-3 days Canine permanent MCAO model of ischemic stroke 371 post -stroke as necessary Neurobehavioral...
  • 8
  • 259
  • 0
báo cáo hóa học:

báo cáo hóa học:" Effect of combined treatment with alendronate and calcitriol on femoral neck strength in osteopenic rats" doc

... improvements in bone mass and strength at the femoral neck than either intervention alone Therefore, we aimed to investigate the effect of combined treatment with alendronate and calcitriol on bone mass ... Marcolongo R: Effects of combined treatment with calcitriol plus alendronate on bone mass and bone turnover in postmenopausal osteoporosis: two years of continuous treatment Clin Drug Invest ... low With more rats, any synergistic effect of combination alendronate and calcitriol therapy on bone mass and strength might become evident Finally, we did not examine bone strength of the femoral...
  • 10
  • 431
  • 1
Báo cáo y học:

Báo cáo y học: " Evolution of changes in the computed tomography scans of the brain of a patient with left middle cerebral artery infarction: a case report" pps

... immediate CT brain scan in acute middle cerebral artery (MCA) infarction may initially appear normal and the low density area may not be apparent Some early signs of acute MCA infarction are loss of ... contrast (unenhanced) thus avoiding potential confusion with subarachnoid haemorrhage Below, we summarise the findings and analysis of CT scanning of the brain Normal brain and fundamentals of ... (white) may be seen within the choroid plexus and occasionally within the basal ganglia Acute haemorrhage appears as an area of high density (white) There is often surrounding low density oedema with...
  • 4
  • 508
  • 0
A modelling study of h2s absorption in pure water and in rainwater

A modelling study of h2s absorption in pure water and in rainwater

... WATER AND IN RAINWATER iv TABLE OF CONTENTS APPENDIX C : RAINWATER ANALYSIS 105 A MODELLING STUDY OF H2S ABSORPTION IN PURE WATER AND IN RAINWATER v SUMMARY SUMMARY The removal of H2S from industrial ... MODELLING STUDY OF H2S ABSORPTION IN PURE WATER AND IN RAINWATER Treated Gas Out HF Idealised solvent absorption acid gas removal process A W A MODELLING STUDY OF H2S ABSORPTION IN PURE WATER AND IN ... the examination of the phase A MODELLING STUDY OF H2S ABSORPTION IN PURE WATER AND IN RAINWATER CHAPTER INTRODUCTION behaviour of H2S in rainwater The modelling work will be done by applying the...
  • 129
  • 369
  • 0
Gene expression profile in the middle cerebral artery and frontal cortex of hypertensive rabbits

Gene expression profile in the middle cerebral artery and frontal cortex of hypertensive rabbits

... regulated genes in the frontal cortex 48 Table 4: Down regulated genes in the frontal cortex 50 Table 5: Up regulated genes common in the middle cerebral artery and frontal cortex ... quantitatively and morphologically in 10 New Zealand White rabbits with and without hypertension, induced using the 2kidney, 1-clip Goldblatt hypertension model Genes in the frontal cortex and middle cerebral ... understanding of the molecular mechanisms involved in the pathophysiology of the cardiovascular system has been gained from in vitro studies Nevertheless, the role of specific gene products in cardiovascular...
  • 92
  • 358
  • 0
Modelling study of a container distribution system for high rise factories

Modelling study of a container distribution system for high rise factories

... 2.1) obtained from Mannesmann Demag (a company that manufactures and installs container hoists) shows that Hong Kong has many high- rise factories and warehouses that utilize container cranes to ... arrival rates is analyzed 24 CHAPTER ANALYTICAL STUDY OF PROPOSED CONTAINER DISTRIBUTION SYSTEM Queueing arises whenever there is more demand for service than there is capacity for service available ... land area and large capital cost A better alternative system is one that delivers the containers to the various floors of a high- rise factory by other means, instead of the existing vehicular ramp...
  • 80
  • 276
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A case study of the College English Test and ethnic minority university students in China: negotiating the final hurdle" pptx

... of the total score For instance, the weighting of English is 150 out of 630 points in Shanghai and 120 out of 480 points in Jiangsu Province The College English Test (CET) is a national examination ... foster trilingualism in ethnic minority students: the minority language, Chinese and English In regions where trilingualism is promoted in a supportive manner, the minority language is taught in primary ... Putonghua and standard written Chinese) and English, these students have experienced trilingualism in their primary and secondary education, studying their mother tongue, Chinese and English since...
  • 11
  • 649
  • 0
báo cáo hóa học:

báo cáo hóa học: " A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel" doc

... Sterud et al.: A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel ... among ambulance personnel are mainly related to ambulance specific stressors • Health complaints and low job satisfaction among ambulance personnel are mainly related to general job- related stressors ... http://www.occup-med.com/content/6/1/10 Page of Table Means, standard deviations and comparison between the sample available at T1 only and the sample available at both T1 and T2 Sample T-test (T1 and T2) sample vs sample (n...
  • 9
  • 531
  • 0
báo cáo hóa học:

báo cáo hóa học:" The integrated care pathway reduced the number of hospital days by half: a prospective comparative study of patients with acute hip fracture" doc

... to the patient motivation, the care of patients with a hip fracture requires a team approach in which the co-ordination between the various aspects of care is important Integrated care pathways ... further research [17] The aim of the present study was to evaluate the effectiveness of an ICP in patients with an acute fracture of the hip The main outcome measure was the length of hospital ... interviewing nurse assessed the patients' nutritional status and symptoms of other potential problematic areas At discharge, the patients' dependency on a walking aid and gait capacity was measured in...
  • 7
  • 305
  • 0
báo cáo hóa học:

báo cáo hóa học:" Acromioclavicular joint dislocation: a comparative biomechanical study of the palmaris-longus tendon graft reconstruction with other augmentative methods in cadaveric models" docx

... the statistical analysis and drafted the manuscript CKY was involved in the conception, participated in the coordination of the study and data analysis DAS and SS were involved in the critical revision ... acromion was in total contact with the lateral end of the clavicle [See Additional file 1] The distal clavicular reference point was defined as the point on the clavicle in contact with the acromial ... clavicle hook plate does not address posterior-anterior instability and translation of the acromoclavicular joint A routine repair or reconstruction of the acromioclavicular joint capsuloligamentous...
  • 10
  • 738
  • 0

Xem thêm

Từ khóa: động mạch não giữa middle cerebral artery mcaline a model for the study of the association between inflammation and abcg2 mediated multi drug resistancea gender balanced approach to the study of childhood aggression and reciprocal family influencesnóo gia middle cerebral artery 31 42động mạch não giữa middle cerebral artery 31 42the study of the origin history structure and processes of the earthecology is the study of the interaction between organisms and their environmentplant ecology is the study of the interaction between plants andsome developments in the study of market choice public choice and institutional choiceimmunoprecipitation immuno blotting and immunohistochemical study of actin α actinin 4 α tubulin and myosincc patel rm dakhara sl jariwala jk 2010 quot in vitro cytotoxicity study of agave americana strychnos nuxvomica and areca catechu extracts using mcf 7 cell line quot j adv pharm technol res 1 2 pp 245 52first principle study of the metal support interactions and o2 dissociation on single atom pt wxc 100a multicentre double blind randomized clinical trial of intravesical bacillus calmette guérin and interferon alpha 2b in the treatment of superficial bladder cancermorphology of human embryonic stem cells and induced pluripotent stem cells cultured in feeder layer free conditionsthe possibility of epigenetic alterations regulatory rnas and post translational modificaNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ