Lanosterol is a survival factor for dopaminergic neurons

... survival factor for dopaminergic neurons Figure 2: Major classes of lipids and their structures found in mammalian brain Page 19 Lynette Lim Lanosterol is a survival factor for dopaminergic neurons ... that at this timepoint about 35% of dopaminergic neurons have degenerated (Jackson-Lewis et al., 1995) Page 21 Lynette Lim Lanosterol is a survival factor for dopaminergic neurons Lipid standards ... hippocampal neurons Page 41 Lynette Lim Lanosterol is a survival factor for dopaminergic neruons Figure 9: Tau1 staining and segmentation analysis of hippocampal neurons cultures Scale bar represents...

Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

... occupation and age [14] Paternal age has been linked to schizophrenia since 1958 [15] Most studies including a recent metaanalysis have confirmed paternal age as a risk factor for schizophrenia [16-24], ... respectively) Logistic regression analysis (Table 4), adjusting for the effect of maternal age, birth rank and family history, indicated that paternal age is an independent predisposing factor to schizophrenia; ... employment, education, paternal age, maternal age, paternal and maternal age at parturition, family history of psychotic disorders, number of children, birth rank within siblings, and age of disease onset...

Báo cáo y học: "Aboriginal status is a prognostic factor for mortality among antiretroviral naïve HIV-positive individuals first initiating HAART" ppt

... multivariate analysis shows that only baseline HIV plasma viral load, age, education, adherence, and history of IDU were associated with HIV plasma viral load response The univariate and multivariate ... by fluorescent monoclonal Page of (page number not for citation purposes) AIDS Research and Therapy 2006, 3:14 antibody analysis (Beckman Coulter, Inc., Mississauga, Ontario, Canada) Study participants ... which showed racial inequality in pharmaceutical access [22] In British Columbia, Canada, where antiretrovirals are distributed at no cost, Aboriginal ethnicity was negatively associated with receiving...

Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

... indicated Matrin deletion mutants; cells were fixed and stained with anti-HA antibody and alexa 488 tagged secondary antibody Intracellular distribution of matrin3 was examined by confocal imaging ... spliced HIV-1 mRNAs Table List of Human and Mouse PTB-1 interacting proteins identified by yeast hybrid assay PTB-1 interacting proteins identified by yeast hybrid assay Other names/synonyms Accession ... 5′-CTAGTCAAAATTTTTGGCGTACTC -3 and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG -3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3 and GAPDH reverse 5′ TTAAAAGCAGCCCTGGTGAC...

Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

... that recent and recurrent episodes of acute chest syndrome are risk factors for cerebral vascular accidents [10] Our findings of increased cerebral vascular accidents in patients with sickle cell ... series, children with a history of asthma and sickle cell disease developed acute chest syndrome and cerebral vascular accidents more frequently than children with sickle cell disease without asthma ... pulmonary infiltrates or arterial hypoxemia The study excluded children with an exacerbation of reactive airways disease If patients with sickle cell disease are at increased risk of airway inflammation...

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... reactivating factors – that is, subunit swapping might occur However, no biochemical evidence for this has been obtained so far A similar reactivating factor for ethanolamine ammonia lyase has been ... responsible for the reactivation of the inactivated holoenzymes of DD [1 5–1 7] and glycerol dehydratase [1 8–2 0] were found, and designated DD-reactivating factor and glycerol dehydratasereactivating factor, ... we have to await the structural analysis of a real enzyme reactivase complex A B Experimental procedures Fig Subunit swapping between DD and the reactivase (DD-R) (A) and the existence of a cavity...

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... SDF-1-unstimulated and stimulated HeLa cells were treated with a 1941 Syndecan-4 is an auxiliary receptor for SDF-1 /CXCL12 N Charnaux et al A C B Fig Heparan sulfate is involved in the tyrosine phosphorylation ... ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 382, 833–835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T,...

Báo cáo khoa học: "Upper abdominal body shape is the risk factor for postoperative pancreatic fistula after splenectomy for advanced gastric cancer: A retrospective study" ppsx

... through the drains once or twice a day Definition of Postoperative Pancreatic Fistula (POPF) A case of POPF had to satisfy the criteria for the postoperative pancreatic fistula after pancreaticoduodenectomy: ... a deep abdominal cavity to decrease the risk of postoperative pancreatic fistula It is easy to measure the CAD and CATD at the level of the root of celiac artery by preoperative CT, and we can ... Predictive factors for pancreatic fistula after pancreaticosplenectomy for advanced gastric cancer in the upper third of the stomach J Gastrointest Surg 2006, 10:132-137 Ichikawa D, Kurioka H, Yamaguchi...

Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

... Prognostic Factors Tumori 2009, 95:461-6 doi:10.1186/1748-717X-5-116 Cite this article as: Yamazaki et al.: Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue ... Assessment of influence of smoking, drinking, leukoplakia and dental irritation on Local Control of Early Oral Tongue Carcinoma Treated with Brachytherapy: Age and Dental Factor are potential Prognostic ... Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, Ikeda H: Prospective trial of radiotherapy for patients 80 years of age or older with squamous cell carcinoma of the...

Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx

... around the ring However we speculate that Dacron ring traction from the annular stitch may distort the normal planar geometry of Mitroflow pericardial bioprosthesis, leading to distortion of the ... bioprosthesis ring At preoperative coronary angiography a distorted bioprosthesis ring was detected in all patients (Figure 2) An explanted bioprosthesis with leaflet distortion and right coronary leaflet ... factor for early calcification? Journal of Cardiothoracic Surgery 2010 5:77 Author details Department of Cardiovascular Surgery, Santiago de Compostela University Hospital La Choupana, Santiago de...

Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx

... limitations associated with the retrospective analysis of a prospective study, our data indicate that early postoperative hyperglycaemia is more likely to be a risk marker than a risk factor in a patient ... least from aggressively correcting hyperglycaemia We investigated whether postoperative hyperglycaemia is a risk factor for postoperative infections and prolonged in- hospital stay in a cohort of ... outcome Logistic regression analysis was used for infectious complications, and linear regression analysis was used for length of stay Because of nonparametric distribution, length of stay data were...

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

... of obesity as a risk factor for low back pain A significant difficulty in ascertaining cause and effect between obesity and low back pain is undoubtedly the term "low back pain" itself Low back ... back pain and obesity, these may be confounding factors [28] Other variables such as less activity and/or muscular weakness leading to obesity are also possible considerations Obesity and low back ... basic research appeared to conclude what was already intuitively thought about low back pain and increased weight Body mass index Before an in-depth discussion of low back pain and obesity can...

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

... therefore appears to induce stem cell transmigration across an endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant ... migration It is suggested that glioma modulated ECM may act as a local guidance for NSC homing in addition to other growth factors or signaling pathways [72] Glioma- produced ECM can play an important ... imaging, NSCs migrated along HGF gradient We conclude that HGF is a major chemoattractant in NSC homing to glioma VIII List of Tables Table List of pre-clinical trials that make use of NSCs as...

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

... def (digestive- organ expansion factor) IS A CRUCIAL GENE FOR THE DEVELOPMENT OF ENDODERM- DERIVED ORGANS IN ZEBRAFISH (Danio rerio) RUAN HUA (M.Sc., Wuhan University, P.R.China) A THESIS SUBMITTED ... before reviewing zebrafish intestine, liver and pancreas organogenesis 1.3.1 Endoderm formation in zebrafish 1.3.1.1 Endoderm formation and endoderm marker genes Fate mapping studies in zebrafish ... organogenesis 1.3.4 Pancreas morphogenesis in zebrafish 1.3.4.1 Exocrine and endocrine pancreas in zebrafish Like the mammalian pancreas, zebrafish pancreas is also composed of two tissues, endocrine pancreas...

Xem thêm