The role of serum amyloid A1(SAA1) in coronary artery disease

The role of serum amyloid a in atherosclerosis

... minimization of tissue damage and promotion of healing (Baranova et al., 2010; Sandri et al., 2008) In the event of a tissue injury, the acute phase response initiates the activation of a cascade, ... indication of the involvement of macrophages in plaque rupture (Boyle, 2005) 1.3 Serum Amyloid A (SAA) SAA is a 12.5kDa acute phase reactant which plays a role in the acute phase response The host ... Receptor Interacting Protein (RIP1) instead of with Fas associated death domain (FADD) and caspase would activate the NFκB survival mechanism (Oeckinghaus et al., 2011) As the absence of TRAF2 would...

The role of serum amyloid A1(SAA1) in coronary artery disease

... facilitating its growth and hence angiogenesis is pro-atherogenic The final stage in the development of an atheroma involves the rupturing of a plaque Plaque rupturing involves the erosion of the ... important for the binding of SAA1 to components of the extracellular matrix (Uhlar and Whitehead 1999) The only reported role of the C-terminal domain is its facilitation of the binding of SAA1 to ... on atherosclerosis In a study by Meek et al, mRNA of A-SAA was found in important components of the atherosclerotic lesion including endothelial cells lining the lumen of coronary artery, the...

Báo cáo khoa học: The role of ADAM10 and ADAM17 in the ectodomain shedding of angiotensin converting enzyme and the amyloid precursor protein ppt

... that both ADAM10 and TACE are involved in the shedding of APP, neither ADAM is involved in the shedding of ACE Furthermore we show that APMA can distinguish between the shedding of ACE and APP ... would appear that ADAM10 and TACE are not critically involved in the shedding of ACE APMA has been reported to induce the shedding of a number of protein ectodomains, including APP, from CHO ... shedding of ACE but not the shedding of APP from two different cell lines To determine whether the APMA-induced shedding of ACE was mediated by the same protease as the constitutive shedding of...

Investigation of the effects of serum amyloid a on human endothelial cells implications in atherosclerosis

... not a major acute phase protein and has not been regarded as a biomarker of CAD 1.4 Endothelial proinflammation 1.4.1 Endothelial proinflammation in atherosclerosis Ross proposed in 1999 that atherosclerosis ... acute inflammation, its an-inflammatory function could be reduced 15 1.2.2 A biomarker of atherosclerosis The characterization of SAA as both an inflammatory protein and an apolipoprotein generate ... apolipoprotein ATF3: activating transcription factor BHLHB: basic helix-loop-helix domain containing, class B CAA: carotid artery atherosclerosis CAD: coronary artery disease CAG: diagnostic coronary angiography...

Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

... stable supply of knowledge and skills in high need areas Increase the size, diversity of skills and productivity of the labor force Dimensions of Social and Economic Value Regional public institutions ... business Best Practice Highlights Slippery Rock University Regional Learning Alliance – workforce development and training/collaborations with business and industry; meeting the training and ... sources of innovation that can provide the impetus for economic development Applying knowledge and forming intellectual capital Nearly two-thirds of National Association of State Universities and Land-Grant...

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...

Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding afﬁnity pptx

... observed in weaker binders Evaluation of the VH ⁄ VL interaction strength To evaluate the VH ⁄ VL interaction strength of these 36 clones, phages were used to infect a nonsuppressing strain, HB2151, ... strong VH ⁄ VL binder, to describe the relationship, and also to identify key residues in determining the interdomain interaction strength Results Construction of an FR2 combinatorial library To investigate ... evaluating either Fv-antigen or VH ⁄ VL interactions [12] As a target for the analysis, we focused on the two framework region (FR2) regions of VH and VL, each facing the domain interface of the anti-lysozyme...

Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

... Claire Cardie, Vincent Ng, David Pierce, Chris Buckley Examining the role of statistical and linguistic knowledge sources in a general-knowledge que stion answering system In Proceedings of the 6th ... periments with Open-Domain Textual Question Answering In the Proceedings of the 18th International Conference on Computational Linguistics (COLING-2000), pages 292298, 2000 Frederick Jelinek, John ... the role of lexico-semantic feedbacks Table lists the quantitative analysis of the feedback loops Loop was generated more often than any other loop However, the small overall average number of feedback...

Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

... 5.2.) Hypothesis 2: When the gift recipient s perception of prior attitude toward a brand is neutral and the giver -recipient relationship is strong, then the gift recipient s post -brand attitude ... level of recipient s perception of prior brand attitudes - Hypothesis 7a: The recipient s post brand attitude change is greater when receiving the prior neutral brand than the prior favorable brand ... self-interest or obligation motives Rather, Goodwin et al (1990) suggested that there may be elements of self-interest and obligation as a joint motive of the gift- giver Gift- giving occasion Gift- giving/receiving...

The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf

... Sherraden, and Julia Stevens for comments CENTER FOR SOCIAL DEVELOPMENT WASHINGTON UNIVERSITY IN ST LOUIS i REDUCING WILT The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College ... Destin, 2009) Charles, Roscigno, and Torres (2007) is the only study of the seven to examine the relationship between parent school savings and college attendance They find that having savings ... UNIVERSITY IN ST LOUIS REDUCING WILT contrast, only 20% of youth who have an account, and 26% of youth with savings designated for school experience wilt The Role of Savings and Wealth in Reducing Wilt...

Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf

... glucokinase and hexokinase I in distinct pools [3,24], or by the involvement of mechanisms, additional to Glc6P, in mediating the effects of glucokinase overexpression As glucokinase binds to a dual-speciﬁcity ... [5,7] Conditions that cause dissociation of glucokinase from GKRP are associated with a parallel increase in the cell content of Glc6P, conﬁrming the regulatory role of GKRP on glucokinase activity ... understanding of the contribution of Glc6P to the metabolic effects of glucokinase overexpression in hepatocytes and to test for evidence for additional mechanisms We used an inhibitor of glucose 6-phosphate...

Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

... (particularly the short ones) have all zeroes in them In other words, none of the bigrams from the training set appears in these reviews This suggests that the main problem with the bigram model ... and E Hovy 2004 Determining the sentiment of opinions In Proc of COLING, pages 1367–1373 M Koppel and J Schler 2005 Using neutral examples for learning polarity In Proc of IJCAI (poster) D Lin ... Lawrence, and D M Pennock 2003 Mining the peanut gallery: Opinion extraction and semantic classification of product reviews In Proc of WWW, pages 519–528 A Esuli and F Sebastiani 2005 Determining the...

Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf

... clear upregulation of an alkane-inducible cytochrome P450 (AJ273607) The role of P450 in microbial fatty acid metabolism during the ﬁrst hours of incubation [22] According to amino acid similarity, ... compounds is inherently coupled to fatty acid degradation because the conversion of alkanes to fatty acids is The role of P450 in microbial fatty acid metabolism an essential step in the alkane ... and ⁄ or fatty acids Fatty acid degradation – omega oxidation Although cytochrome P450s not intervene in the degradation of fatty acids in the b-oxidation cycle itself, they take part in the steps...

The Role of Interest Rate Swaps in Corporate Finance doc

... explains the basic mechanics of interest rate swaps and examines these rationales in more detail FUNDAMENTALS OF INTEREST RATE SWAPS The most common type of interest rate swap is the fixed/floating ... Fixed/Floating Swap The quoted price of an interest rate swap consists of two different interest rates In the case of a fixed/floating swap, the quoted interest rates involve a fixed and a floating rate The ... trading in interest rate swaps has helped to complete forward markets and to lower the cost to firms of managing their exposure to interest rate risk The Role for Hedging in the Theory of Corporate...

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

... bridging the A and G b-strands of the I27 protein during the main unfolding barrier.[39] To further validate this view and gain insight into the role of solvent hydrogen bonds in protein unfolding, ... separating b-strands In Figure B, we define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand ... molecular dynamics (SMD) simulations have shown that for I27 rupture of a pair of hydrogen bonds in the A and B b-strands near the amino terminus of the protein domain causes an initial extension of...

Xem thêm

Từ khóa: the role of data link layer in osi model the role of termites and ants in soil modification the role of language and communication in conflict management the role of nature and nurture in language acquisition the role of capital markets authority in kenya the role of transport and communication in economic development of nigeria the role of transportation and communication in economic development of a country the role of termites and ants in soil modification a review 2 what is the role of data link layer in osi model pdf the role of new communication technologies in development the role of capital market authority in kenya the role of capital market intermediaries in the dotcom crash explain the role of data link layer in osi model describe the role of school and teachers in shaping one personality the role of transportation and communication in national development Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ