0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Identification of PARP1 as a transcriptional regulator of HBV replication

Identification of PARP1 as a transcriptional regulator of HBV replication

Identification of PARP1 as a transcriptional regulator of HBV replication

... Acetylation Inhibition Activation PARP1 Enzymes that result in PARP1 modification PP5 P PARP1 PARP2 ERK2 CaMK PARP3 PARG p300 SUMO3 Casp3 /CBP SUMO1 Casp7 R P PARP1 R R R Ac PARP1 PARP1 PARP1 Su PARP1 ... by activated PARP1, as PAR can be added onto PARP1 by other members of the PARP family such as the DNA repair enzyme PARP2 PARP1 can also exert its effects as an inactive enzyme For example, acetylation ... 35 Variable HBV Replication driving HBV pgRNA transcription, as well as a transfection efficiency marker to ascertain that undetectable HBV replication was not due to poor uptake of the plasmid...
  • 259
  • 313
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... Na -palmitoylation of Gas is regulated also remains unclear However, we assume that mammalian Gup1 competes with Skn for Shh to prevent palmitoylation rather than catalyzing depalmitoylation of ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon for...
  • 14
  • 499
  • 0
Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf

Báo cáo khoa học: MNB⁄ DYRK1A as a multiple regulator of neuronal development pdf

... overproliferation can alter the balance between neuronal populations, leading to mental disorders and neuropathologies MNB ⁄ DYRK 1A has also been implicated in various aspects of late neuronal differentiation ... Bescond M & Rahmani Z (2005) Dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK 1A) interacts with the phytanoyl-CoA alphahydroxylase associated protein (PAHX-AP1), a brain specific ... increased dosage of DSCR1 and DYRK 1A on chromosome 21 Nature 441, 595–600 Gwack Y, Sharma S, Nardone J, Tanasa B, Iuga A, Srikanth S, Okamura H, Bolton D, Feske S, Hogan PG et al (2006) A genome-wide...
  • 13
  • 512
  • 0
Báo cáo y học:

Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt

... UCSC annotated sequences (UCSC Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other ... pre-miR-30d, RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacturer’s protocol Real-time ... et al.: Small RNA sequencing reveals miR64 2a- 3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis Genome Biology 2011 12:R64 Submit your next manuscript...
  • 13
  • 365
  • 0
Báo cáo y học:

Báo cáo y học: " siRNA screen of the human signaling proteome identifies the PtdIns(3,4,5)P3-mTOR signaling pathway as a primary regulator of transferrin uptak" docx

... signaling pathway (b) Quantification of the effects of different siRNAs targeting the PtdIns(3,4,5)P3-mTOR pathway and rapamycin (RAPA) on transferrin uptake Means ± standard error of the mean ... uptake is under the control of the PtdIns(3,4,5)P3-mTOR signaling pathway Identification of the mTOR pathway as primary signaling module controlling transferrin uptake The PI3K-mTOR pathway controls ... of the players, as well as of the direction of the effects, a signature of a particular signaling pathway In addition to signature proteins of the PtdIns(3,4,5)P3-mTOR pathway, the other hits...
  • 11
  • 286
  • 0
Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

... example, ATPase /helicase activity is found associated with TFIIH and chromatin remodeling complexes and plays crucial roles in transcriptional initiation and preinitiation The ATPase /helicase activity ... recombinant TNF -a was purchased from Roche interference RNA (siRNA) 5¢-GCAUAAAACUUCUGC GUCU-3¢ was targeted to the RHA portion from 2408 to 2426 Control siRNA 5¢-AUUCUAUCACUAGCGU GAC-3¢ was purchased ... ATP-binding and helicase activity, the enzymatic activity of RHA is required for the transcriptional activation mediated by NF -jB RHA is a nucleic acid helicase that unwinds doublestranded DNA and RNA...
  • 11
  • 485
  • 0
Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

... (5’-CATAATGACTGGGCAAACTCATCTACCACTGCTCAA-3’) L30/43 -AS 2AY -AS1 01 (5’-TTGAGCAGTGGTAGATGAGTTTGCCCAGTCATTATG-3’) (5’-CCGCTCGAGTTACTGATCATCCAACCACAGAAG-3’) 2A- AS3 01 (5’-GCTCTAGACTGATCATCCAACCACAGAAG-3’) CoxB2AY-S ... 2AY-11 0AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) 2AY-13 0AS VP1 / 2A- S (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) (5’-CCATCGATATGATGGGTACGTTC-3’) 2A- S10 (5’-GGAATTCATGGGGAAATTTGGACAGCAG-3’) 2A- AS2 (5’-GCTCTAGACTACTGCTCCATGGCTTCATCATC-3’) ... (5’-CCGCTCGAGTTACTGCTCCATGGCTTC-3’) 2AY-21S (5’-GGAATTCCATCTTGCTACTCATAA-3’) 2AY-41S (5’-GGAATTCCTCGTATCATCTACCAC-3’) 2AY-61S (5’-GGAATTCGGAGTGTATTATTGTAA-3’) 2AY-9 0AS (5’-TTATTAATAATACTCGCTGGCCTC-3’) 2AY-110AS...
  • 9
  • 244
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are...
  • 11
  • 396
  • 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... Transglutaminasecatalyzed inactivation of glyceraldehydes 3-phosphate dehydrogenase and a- ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length Proc Natl Acad Sci USA 94,...
  • 17
  • 440
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... (Rheumaklinik Aachen, Aachen, Germany), Prof Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany) To assess further the assay specificity, we analyzed ... studies are necessary to screen known autoantigens containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti -SmD3 peptide (SMP) assay (a) Intra-assay ... Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis The intra-assay and interassay variability, expressed as coefficient of variation in percentage...
  • 11
  • 593
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of kinectin as a novel Behçet''''s disease autoantigen" doc

... cells, and antibody to endothelial cell antigen (AECA) has been reported Reports on the prevalence of AECA have varied largely and alpha-enolase was reported as one of the putative target antigens ... kinectin by screening an aplastic anemia patient for candidate antigens using a Clontech human fetal liver cDNA expression library and it was concluded that seven out of 18 aplastic anemia patients ... analysis of the association of anti -kinectin antibody with different manifestations or disease 'subtypes' of BD is another important project Anti -kinectin is clearly only one of the antigen-antibody...
  • 7
  • 519
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of citrullinated α-enolase as a candidate autoantigen in rheumatoid arthritis" doc

... Sugaya M, Hanagiri T, Yasumoto K: [Tumor marker in primary lung cancer] J UOEH 2004, 26:473-479 38 Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida ... citrullinated α-enolase by immunoblotting This suggests that citrullinated α-enolase is at least as immunodominant as citrullinated filaggrin or citrullinated vimentin, because, by immunoblotting, the ... controls lase in RA of antibodies against deiminated and undeiminated α-enolase in RA patients and healthy controls Immunoblotting of in vitro citrullinated and untreated α-enolase with serum samples...
  • 9
  • 397
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

... as: Krishnan et al.: Identification of Glyceraldehyde-3phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells ... Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal actions of parasporin-2, an anti-tumor crystal toxin from Bacillus ... (Gly-Lys-Val-LysVal-Gly-Val-Asn-Gly-Phe-Gly-Arg-Ilc-Gly-Gly) The amino acid sequence was analysed using the NCBI BLASTP; Swiss-Prot database and identified as G3PHuman -Glyceraldehyde-3-phosphate- dehydrogenase...
  • 11
  • 366
  • 0
Báo cáo y học:

Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot

... skin A videomicroscopic analysis Arch Dermatol 1998, 134:563-568 Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of ... clinical diagnosis Arch Dermatol 1995, 131:298-304 Saida T, Yoshida N, Ikegawa S, Ishihara K, Nakajima T: Clinical guidelines for the early detection of plantar malignant melanoma J Am Acad Dermatol ... primary care physicians In the UK, courses have been running for a number of years and include a range of health care practitioners The most recent meta analysis of dermoscopy [36] has encompassed...
  • 6
  • 413
  • 0
báo cáo khoa học:

báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx

... important for ATP binding, has no kinase activity [13] To examine whether purified GST-AtHaspin has kinase activity, an in vitro kinase assay was performed using purified GST-AtHaspin and GST-AtHaspin ... Dlk/ZIP kinase orthologues, and thus, AtHaspin has an additional role as a H3 Thr11 kinase in A thaliana Phosphorylation of histone H3 at Thr3 and Thr11 Mitotic phosphorylation of histone H3 at Ser10, ... (http://psort.nibb.ac.jp/form.html) Gray box indicates kinase domain (C) Multiple alignment of kinase domain of AtHaspin, human Haspin, and fission yeast Haspin Missing residues are shown as dashes, identical amino...
  • 14
  • 333
  • 0

Xem thêm

Từ khóa: allelopathy of velvetbean determination and identification of l dopa as a candidate of allelopathic substanceshas attracted increasing attention as a component of amperometriclglutamate sensors used in the food industry and clinical biochemistry the precursor of lgoxchulalongkorn university in thailand this smalllab kit was created as a result of the research project entitled chemistry laboratory based on chemical safety and pollution minimization sponsored by thai research fund rdg 3072543 one of the outcomes of texporting the results of a query as a stringthe development of arabic as a written languagecurriculum development as a response to the needs of the societymy experience of learning english as a second languagethe nature of biology as a science of lifethe effect of terminologies on attitudes toward advertisements and brands consumer product knowledge as a moderatorunderstand the nature of biology as a science of lifea unified statistical model for the identification of english basenpwhat is ethics as a philosophical study of moralitymeaning of the maltese cross as a firefighterdescribe the development of cancer as a multistep processmodels of english as a school subjectBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ