Theoretical and experimental studies on nonlinear lumped element transmission lines for RF generation
Theoretical and experimental studies on nonlinear lumped element transmission lines for RF generation
... studied: a) nonlinear capacitive line (NLCL) where only the capacitive component is nonlinear; b) nonlinear inductive line (NLIL) where only the inductive component is nonlinear; and c) nonlinear ... rise time of the output pulse and only a handful reported having done simulations for RF generation These simulations for RF generation not include resistive losses and the authors not show how ... Parametric Studies on NLETL 31 ix LIST OF FIGURES Figure 1.1 RF generation in NLETL Figure 1.2 Dispersion and nonlinear effects in NLETL Figure 2.1 Circuit diagram of a nonlinear lumped element transmission...
- 174
- 394
- 0
Theoretical and experimental studies on the promoting effect of boron on cobalt catalyst used for fischer tropsch synthesis
... THEORETICAL AND EXPERIMENTAL STUDIES ON THE PROMOTING EFFECT OF BORON ON COBALT CATALYST USED FOR FISCHER- TROPSCH SYNTHESIS (FTS) TAN KONG FEI (B Eng & M Phil., University of Malaya, ... Armando Borgna, Mark Saeys, Effect of Boron Promotion on the Stability of Cobalt Fischer- Tropsch catalyst , Journal of Catalysis, 280 (2011), 50 XX CHAPTER INTRODUCTION Fischer- Tropsch Synthesis ... 2010) The objective of this thesis is therefore to first understand the mechanism responsible for the deactivation of Co catalyst under realistic FTS conditions The deactivation of Co catalysts...
- 183
- 449
- 0
Theoretical and experimental investigation on nanostructures
... will focus on the theoretical and experimental study of one-dimension nanostructures to control their physical properties and investigate their possible applications One-dimensional nanostructures, ... Electron densities of (a) the top valence band and (b) the bottom conduction band of ZZ-1 (6, 0); (c) the top valence band and (d) the bottom conduction band of ZZ-1 (9, 0); (e) the top valence band ... representation of the cross section of the barrier layer where the oxide formation zone and the oxide dissolution zone adjacent to the m/o interface and the e/o interface, respectively, and the ionic...
- 219
- 186
- 0
Experimental and numerical studies on the viscoelastic behavior of living cells
... Literature review 17 contribution of the cell membrane and spectrin network to the large deformation of red cells On the other hand, the continuum modeling approach treats the cell as a continuum material ... EXPERIMENTAL AND NUMERICAL STUDIES ON THE VISCOELASTIC BEHAVIOR OF LIVING CELLS ZHOU ENHUA (B.Eng., WUHEE & M.Eng., WHU) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... that the experimental methodology and theoretical model put forward in this thesis will contribute to a more accurate evaluation of the viscoelastic properties of cells and better understanding of...
- 191
- 275
- 0
Some experimental studies on vortex ring formation and interaction
... a Vortex Ring 3.5.4 Circulation of a Vortex Ring 63 65 65 67 67 3.6 Experimental Conditions 69 Chapter Results & Discussion 4.1 Circular Vortex Rings 4.1.1 Formation of the a Circular Vortex Ring ... interesting and complicated dynamics The third section reviews some past studies on the interaction of a vortex ring with a circular cylinder, and discussion on the cut -and- reconnection phenomena ... the boundary conditions affect not only the formation number, but also the formation characteristics and the structure of the vortex ring One such condition, which affects the formation characteristics,...
- 209
- 528
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc
... Crystal structure of E53QbsSHMT and its complexes Table Data collection statistics of E53QbsSHMT and its complexes Values in parantheses correspond to highest resolution bin Ligand(s) used None Gly ... belonged to the P21212 space group and contained one monomer in the asymmetric unit Cell dimensions and details of data collection are shown in Table Expression and purification of bsSHMT and E53QbsSHMT ... the enzyme conformation previously exposed to glycine and FTHF is different from that before exposure and that E53QbsSHMT exhibits enzyme memory The slow conformational change seen in the E53QbsSHMT...
- 13
- 514
- 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and LPS-II (well 2) of C braakii PCM 1531, and LPS of Citrobacter ... inhibition of passive haemagglutination, SDS/ PAGE and immunoblotting using O-antisera against C braakii PCM 1531 and PCM 1487 In double immunodiffusion (Fig 4), the LPS of C braakii PCM 1531 and PCM...
- 7
- 478
- 0
Báo cáo hóa học: " Research Article Audio Key Finding: Considerations in System Design and Case Studies on Chopin’s 24 Preludes" pdf
... national and international conferences such as the International Conference on Music Information Retrieval (ISMIR), International Conference on Multimedia and Expo (ICME), and the INFORMS Computing Society’s ... [3] C.-H Chuan and E Chew, “Fuzzy analysis in pitch-class determination for polyphonic audio key finding,” in Proceedings of the 6th International Conference on Music Information Retrieval (ISMIR ... method, and key determination cri- teria The major differences between the systems occur in the audio characteristic analysis, key template construction, ´ and key determination criteria In Gomez’s system, ...
- 15
- 426
- 0
Báo cáo y học: "Figuring out what works: a need for more and better studies on the relationship between ICU organization and outcomes" potx
... includes the training and organization of intensivists With a virtual absence of information relating ICU training with ICU outcomes, many questions remain unanswered Is there an optimal duration of ... Keller A, Tarlov AR, Ware JE: Variations in resource utilization among medical specialties and systems of care: results from the Medical Outcomes Study JAMA 1992, 267:1624-1630 Garland A, Connors AF: ... perform, get funded, and get published The impediments to doing randomized controlled studies of organizational change in ICUs are commonly insurmountable This and other practical considerations...
- 2
- 271
- 0
Theoretical and simulation study on ogston sieving of biomolecules using continuum transport theory
... describe sieving, diffusion and convection of a band of biomolecules passing through a repeated array of nanofilters 14 Chapter Introduction 1.4 Organization of the thesis This thesis is composed of ... approaches 2.1 Free-solution diffusion coefficient of rod-like DNA Diffusion of particles in a solution from a region of high concentration to regions of low concentration is a spontaneous process caused ... discretization and integration 74 6.1 6.2 SPH equations for flux and concentration evolution .77 6.3 SPH formulation of no-flux boundary conditions 78 6.4 Periodic boundary conditions ...
- 125
- 319
- 0
Từ khóa: experimental studies on black layersynthesis spectral magnetic thermal and antimicrobial studies on symmetrically substituted 21 the developmental origins of chronic disease overview of evidence from human and experimental studiesexperimental studies on the survival of pathogens in frozen foodsepidemiological prospective and experimental studiestheoretical and experimental issuest g knowles and others effects on cattle of transportation by road for up to 31 hours veterinary record 145 1999 575 582review of studies on nutritional status and educationepidemiological studies on antioxidants and cardiovascular diseasedescendant child and adjacent sibling selectors selecting an element based on hierarchystudies on growth crystal structure and characterization of novel organic nicotinium trifluoroacytokines and inflammatoryrecruitment in nash experimental and human studiescase studies on hiv and diabetes surveillance in the late 1820s and 30s d d stull and m j broadway slaughterhouse blues the meat and poultry industry in north america case studies on contemporary social issues belmont ca wadsworth publishing 2003 34nonlinear finite element model for the determination of elastic and thermal properties of nanocompositesBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ