Development of compliant mechanisms for real time machine tool accuracy enhancement using dual servo principle
Development of compliant mechanisms for real time machine tool accuracy enhancement using dual servo principle
... its performance characteristics Followed by, the real- time compensation of the following error using the dual servo concept is verified (machines’ servo and secondary flexure mechanisms servo) ... capabilities of using the DTM are manyfolds, still its cost is sky-high To improve the surface integrity of machined components in DTM and to reduce the initial cost of machine a dual servo based real- time ... overall accuracy of the machine tool Hence, to improve the workpiece surface integrity, one needs to reduce the random error of the machine tool close to the target accuracy itself 1.4 Sources of Machine...
- 217
- 451
- 0
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
... template DNA preparation GPV CHV strain, a high-virulence strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province Aleutian disease virus (ADV), canine ... size (bp) GPV-F GPV-R GPV-FP GTGCCGATGGAGTGGGTAAT ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 3122-3143 3098-3120 ... Recommendation of GPV Veterinary Science in China 1962, 8:19-20 (in chinese) Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, Hiraizumi M, Saito S, Yamada T, Haritani M: An outbreak of goose...
- 7
- 338
- 0
Báo cáo khoa học:" Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1?" pdf
... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concentrations of primers each of 0.3 μmol/L and probe of ... real-time PCR standard curve Establishment of the fluorescent quantitative real-time PCR standard curve Standard curve of the AHV-1 fluorescent quantitative real-time PCR Ten-fold dilutions of standard...
- 8
- 266
- 0
Báo cáo khoa học: " Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1" pdf
... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concentrations of primers each of 0.3 μmol/L and probe of ... real-time PCR standard curve Establishment of the fluorescent quantitative real-time PCR standard curve Standard curve of the AHV-1 fluorescent quantitative real-time PCR Ten-fold dilutions of standard...
- 8
- 367
- 0
báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx
... Ashton AR, Tanner GJ, Robinson SP: Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine ... developmental and cellular processes Realtime RT-PCR is currently one of the more powerful and sensitive techniques for analyzing gene expression It provides outstanding accuracy of RNA quantification and ... distributed and assigned a score value between to 100, an arbitrary scoring range For example, the CV values for the 2003 samples ranged from 0.98 for SAND to 2.24 for UBQ-L40 SAND was assigned an arbitrary...
- 11
- 376
- 0
báo cáo hóa học: " Analysis of TDMA scheduling by means of Egyptian Fractions for real-time WSNs" doc
... number of sensors We propose a TDMA scheduling algorithm that complies to the characteristics of both, that is, it is flexible, but also makes use of a rigid framework By means of Egyptian Fractions ... 19800 Number of bytes scheduled id is determined by the number of slots within a frame, while the size of the frame information is determined by the precision of the fractions Altogether, for a network ... the number of full slots and a fractional representation of a slot The fraction of the number of full slots over the total number of slots in a frame is represented by means of Egyptian Fractions, ...
- 20
- 355
- 0
Báo cáo khoa học: "A System for Real-time Twitter Sentiment Analysis of 2012 U.S" pdf
... evolution of public sentiment toward the contenders Conclusion We presented a system for real-time Twitter sentiment analysis of the ongoing 2012 U.S presidential election We use the Twitter “firehose” ... aggregate sentiment and tweet volume within each time period for each candidate For volume, the system outputs the number of tweets every minute for each candidate For sentiment, the system outputs ... unique infrastructure and sentiment model to analyze in real-time public sentiment on Twitter toward the 2012 U.S presidential candidates Our effort to gauge political sentiment is based on bringing...
- 6
- 534
- 0
Báo cáo khoa học: Emerging tools for real-time label-free detection of interactions on functional protein microarrays ppt
... technologies for the real-time label-free detection and characterization of protein interactions that may provide higher resolution functional data Common methods for studying protein interactions Current ... protein interactions with nonprotein biomolecules will depend on the development of labelfree methods for measuring the interactions Coupling functional protein microarrays to real-time label-free detection ... Sensitivity and detection limit will govern the lowest concentration of an analyte that can be detected Label-free detection for protein microarrays sources of nonspecific binding for protein arrays:...
- 14
- 551
- 0
Báo cáo hóa học: "Research Article A Rules-Based Approach for Configuring Chains of Classifiers in Real-Time Stream Mining Systems Brian Foo and Mihaela van der Schaar" pot
... proposed a rules-based framework for reconfiguring distributed classifiers for a delay-sensitive stream mining application with dynamic stream characteristics By gathering information locally at each ... binary classifier partitions input data objects into two classes, a “yes” class H and a “no” class H A binary classifier chain is a special case of a binary classifier tree, where multiple binary classifiers ... different stream characteristics, the proper algorithm to use, for classifier reconfiguration We focus on a chain of binary classifiers as our main application [4], since chains of classifiers are easier...
- 17
- 416
- 0
Báo cáo hóa học: " Research Article Efficient Adaptive Combination of Histograms for Real-Time Tracking" pdf
... loosing real-time capability The formulation allows for the combination of an arbitrary number of histograms with different dimensions and sizes, as well as individual distance functions for each ... mechanism for online adaptation of the feature weights Alternatively, instead of the linear combination D∗ (x) of the distances Dh (q(h) (x(0)), q(h) (x(t))), a linear combination of the simplified ... “Efficient combinaa tion of histograms for real-time tracking using mean-shift and trust-region optimization,” in Proceedings of the 27th Annual Meeting of the German Association for Pattern Recognition...
- 11
- 269
- 0
Báo cáo hóa học: " Research Article Hybrid Modeling of Intra-DCT Coefficients for Real-Time Video Encoding" potx
... compares the performance of a number of transform-based features (including novel features extracted using the discrete curvelet transform) as well as feature set selection methods for visual speech ... “Detection and tracking of humans and faces,” by S Karlsson et al., a framework for multi-object detection and tracking is proposed, and its performance is demonstrated on videos of people and faces ... “Comparison of Nikos Nikolaidis et al image transform based features for visual speech recognition in clean and corrupted video authored by R Seymour et al deals with the important problem of visual...
- 3
- 233
- 0
Báo cáo hóa học: " Research Article Hybrid Modeling of Intra-DCT Coefficients for Real-Time Video Encoding" ppt
... able to further reduce the ZQDCT coefficients for intratransform and quantization and thus has better real-time performance for video encoding Although the video quality degradation is slightly worse ... characteristics of the proposed method and the reference codec [14] for (a) Foreman, (b) Glasgow, (c) Akiyo, and (d) Miss America Additional operations are performed for the calculation of the residual ... since the quantization for intra-DCT coefficients is usually fixed before video processing, the thresholds only need to be calculated once and can be constructed prior to intra-DCT In this way,...
- 13
- 258
- 0
Báo cáo hóa học: " Research Article Embedded System for Real-Time Digital Processing of Medical Ultrasound Doppler Signals" docx
... CONCLUSION In this paper, an embedded system for real-time digital processing of US signals has been presented The system is capable of transmitting arbitrary waveforms, simultaneously demodulating ... perform all needed processing in real time In this paper, an embedded system for multichannel multigate (MCMG) US echography is described The system was conceived and realised as programmable research ... classic spectrogram format [1] Forward/reverse audio is calculated for each selected SV through the processing described above The MCMG system tracks the signal power to search for candidate embolic...
- 7
- 410
- 0
Near infrared confocal raman spectroscopy for real time diagnosis of cervical precancer
... NEAR- INFRARED CONFOCAL RAMAN SPECTROSCOPY FOR REAL- TIME DIAGNOSIS OF CERVICAL PRECANCER SHIYAMALA DURAIPANDIAN 2014 NEAR- INFRARED CONFOCAL RAMAN SPECTROSCOPY FOR REAL- TIME DIAGNOSIS OF CERVICAL ... adjunct to colposcopy for realizing real- time in vivo diagnosis of cervical precancer IX List of Figures Figure 1.1 Anatomy of cervix Figure 1.2 Stages of cervical precancer ... diagnostics 67 3.3 Real- time diagnosis 68 3.4 Conclusion 70 CHAPTER NEAR- INFRARED CONFOCAL RAMAN SPECTROSCOPY ADVANCES IN VIVO DIAGNOSIS OF CERVICAL PRECANCER ...
- 193
- 267
- 0
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the system in a local area Second, the DMC controller is a model-based controller ... controlling the temperature in a room deploying a displacement ventilation HVAC system without heater It is a nonlinear system with large disturbance, which has delay in the control variable and in the...
- 12
- 556
- 0
Từ khóa: the transport layer protocols used for real time multimediathe period of development of the fetus from the time of fertilization to birth is known asdesign and development of low cost friction stir welding machinea comparison of pivot methods for phrasebased statistical machine translationdevelopment of emission inventories for egusdevelopment of emission inventories for non egu point sourcesdevelopment of emission inventories for onroad mobile sourcesdevelopment of emission inventories for other nonroad mobile sourcesdevelopment of international standards for the b isdn in the usgeneral guidelines for real time pcr standard operating procedureobjects processes and behaviors for real time virtual environment applicationscdna synthesis for real time pcrdevelopment of a database for lake ecosystem studies linking gis with rdbmsa real time profiling toolreal time onboard hyperspectral image processing using programmable graphics hardwareBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP