A transmembrane mutation in FcgRIIb reveals the role of ceramide in phagocytosis and autoimmunity
A transmembrane mutation in FcgRIIb reveals the role of ceramide in phagocytosis and autoimmunity
... crystalline state as they contain saturated and unsaturated acyl chains of variable length in which the acyl chains are fluid and disordered In the absence of other lipids, membranes containing ... 1.8) The lipid moiety can vary in terms of chain length of the fatty acids and in the degree of saturation and hydroxylation of the sphingoid base Also, variations in the type, number and linkage ... particle The receptor-ligand interaction activates signal transduction pathways that result in the internalization of the target particle The internalized particle is contained in a plasma membrane...
- 260
- 334
- 0
báo cáo khoa học: " Assessing the role of syringe dispensing machines and mobile van outlets in reaching hard-to-reach and high-risk groups of injecting drug users (IDUs): a review" ppt
... on dispensing machines and 22 on mobile vans Results Introduction of dispensing machines and mobile vans to NSP Syringe dispensing machines were first introduced in Copenhagen, Denmark in June ... Netherlands Milan, Italy Sydney, Australia Berlin, Germany Berlin, Germany New South Wales, Australia Perth and Adelaide, Australia Hindelbank, Switzerland Realta, Switzerland Marseille, France ... Characteristics of users of syringe vending machines in Berlin Sozial und Praventivmedizin 1994, 39(4):209-216 Leicht A: Characteristics and HIV-infection of users of syringe vending -machines and...
- 9
- 422
- 0
Báo cáo khoa học: "A Clinical review: Molecular mechanisms underlying the role of antithrombin in sepsis" docx
... antithrombins are glycosylated at four of their asparagine molecules; these are of the α isoform The remaining 5–15% of circulating antithrombins, of the β isoform, lack glycosylation at asparagine ... purposes) Interaction of antithrombin with endothelium The affinity of antithrombin (AT) to thrombin and its enzymatic inhibition is increased by binding of AT with the heparan-binding site to ... damage to the small intestine in endotoxinaemia In both of these studies, the effect of antithrombin on the leucocyte– endothelium interaction could be abolished by indomethacin, which is an inhibitor...
- 9
- 393
- 0
The role of matrix metalloproteinases (MMP) and their inhibitor in influenza a virus induced host lung injury
... disruption of the capillary-alveolar barrier function results in the leakage of inflammatory exudates, edema fluid and plasma proteins into the lung interstitium and alveolar spaces and the collapse of ... et al, 2010) 2.5 Influenza virus and host defences During an acute influenza virus infection, both arms of immunity: Innate and adaptive, are important in protecting the host against the pathogen ... pathogen The former has a primary goal of limiting virus growth and activating the onset of the adaptive arm, in which viral clearance takes place (Tate et al, 2008) In the early innate phase of host...
- 181
- 496
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢);...
- 11
- 548
- 0
the role of neutrinos, strings, gravity, and variable cosmological constant in particle physics
... The Role of Neutrinos, Strings, Gravity, and Variable Cosmological Constant in Elementary Particle Physics This page intentionally left blank The Role of Neutrinos, Strings, Gravity, and Variable ... N Kursunoglu, Stephan Mink, and Arnold Perlmutter Plenum Press, 2001 The Role of Neutrinos, Strings, Gravity, and Variable Cosmological Constant in Elementary Particle Physics Edited by: Behram ... although these efforts have been mainly unsuccessful, some theorists are still hopeful to obtain results The Role of Neutrinos Strings, Gravity, and Variable Cosmological Constant in Elementary Particle...
- 284
- 2,158
- 0
báo cáo hóa học: " A cohort study of short-term functional outcomes following injury: the role of pre-injury sociodemographic and health characteristics, injury and injury-related healthcare" pot
... this article as: Langley et al.: A cohort study of short-term functional outcomes following injury: the role of pre -injury sociodemographic and health characteristics, injury and injury- related healthcare ... we asked them to characterize their pre -injury functional status for each dimension Explanatory Variables Our review of the literature suggested a range of potential pre -injury and injury- related ... for case co-ordination and/ or management for an acute (rather than gradual onset) injury Those whose injury was the result of selfharm or sexual assault were excluded The ACC manages New Zealand’s...
- 12
- 472
- 0
Báo cáo khoa học: "The role of body mass index and diabetes in the development of acute organ failure and subsequent mortality in an observational cohor" doc
... predicting time to acute organ failure and risk of in- hospital death Diabetes mellitus Body mass index Time to acute organ failure, hazard ratio (95% CI) Risk of in- hospital death during acute organ ... in our analytic cohort Outcome variables The primary outcomes of interest were the risk of the development of acute organ failure within three years of the baseline examination, in- hospital mortality ... manuscript DMM and GSM designed the study, performed and interpreted the data analysis, and drafted the manuscript DED interpreted the data analysis and revised the manuscript All authors read and approved...
- 9
- 501
- 0
the role of supply chain processes and information sharing in supply chain management
... has yet investigated the role of information sharing and supply chain processes in supply chain management under alternative supply chain dynamism that includes both supply chain business environment ... manufacturing firms make investment in information sharing and supply chain processes? Especially, how should firms balance the investment in information sharing and supply chain processes? To date, there ... participating in information sharing change? The study shows that the value of information sharing increases as the number of supply chain members participating in information sharing increases This...
- 265
- 543
- 0
The role of adenosine, adenosine receptors and transporters in the modulation of cell death
... The number of amino acids comprising the extra- and intracellular loops and the extracellular N-terminal and intracellular C-terminal regions of the bovine A1 receptor are indicated in parentheses ... during the adenosine- induced apoptosis in 163 BHK cells Fig 3.70 Activation of caspase during the adenosine- induced apoptosis 165 in BHK cells Fig 3.71 Caspase-3 activity during the adenosine- induced ... ADP, AMP and adenosine, selective antagonism of the effects of adenosine by methylxanthines, activation of adenylate cyclase by adenosine and stimulation of prostaglandin synthesis by ATP and ADP...
- 278
- 355
- 0
The role of small GTPases rap1 and rhoa in growth hormone signal transduction
... mechanism of growth hormone signal transduction 1.4.1 Growth hormone receptor (GHR) and protein tyrosine kinase JAK2 The cellular effects of GH are initiated by the binding of GH to the extracellular ... signaling The aim of this project was to investigate the role of small GTPases Rap1 and RhoA in GH signal transduction Rap1, a close relative of Ras, shares common effectors with Ras and exhibits ... 1.1.1 Growth hormone gene and protein structure 1.1.2 Regulation of growth hormone synthesis and secretion .5 1.2 Growth hormone receptor and growth hormone binding protein (GHBP) 1.3...
- 246
- 351
- 0
The role of health related, motivational and sociodemographic
... representation of the Germanspeaking part of Switzerland Questionnaire The questionnaire contained questions about all of the variables and constructs listed in Fig Most of the predictor concepts and the ... on the package as is mostly the case in Switzerland might be problematic from a public health perspective On the one hand, this format may decrease understanding of the label(30) and on the other ... Sociodemographic and socio-economic variables Gender (x) Age (x) Education (x) Health- related aspects Importance of health and healthy eating (+) Importance of nutritional value of food and health...
- 8
- 272
- 0
A study on issuing corporate bond the case of bank for investment and development of Vietnam -BIDV
... From the reasons, the final thesis titled A STUDY ON ISSUING CORPORATE BOND - THE CASE OF BANK FOR INVESTMENT AND DEVELOPMENT OF VIET NAM” The study provided a real case and updated international ... recommendations on the bond issuance and solutions to develop the primary bond market as well The final thesis aim to: Introduce the international standard and normal practice in issuing corporate bond ... binds the institution to pay certain amounts of money to the owner of the bond on certain dates At the maturity of the bond, the institution agrees to pay fully the bond s face value Face value and...
- 109
- 700
- 0
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx
... oxygen binding with heme, and in turn, can change the affinity of Hb for oxygen The majority of mutations affecting oxygen affinity result in high affinity Hb variants which result in leftward ... along the interface of alpha and beta chains of the Hb tetramer Several hemoglobin variants have substitutions affecting this interface All these substitutions can affect the cooperative nature of ... polycythemia in her mother, maternal grandmother and her younger sister Physical examination was unremarkable Laboratory parameters were remarkable for elevated hemoglobin (17.2 gm%) and hematocrit...
- 5
- 418
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ