Guanidine catalyzed enantioselective mannich reaction towards the synthesis of amino acids
Guanidine catalyzed enantioselective mannich reaction towards the synthesis of amino acids
... GUANIDINE CATALYZED ENANTIOSELECTIVE MANNICH REACTION: TOWARDS THE SYNTHESIS OF -AMINO ACIDS PAN YUANHANG (BSc., Zhejiang University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... the enantioselecitive decarboxylative Mannich and amination reactions of MAHTs catalyzed by bicyclic guanidine in the following chapters The mechanistic study of the decarboxylative Mannich reaction ... malonate Scheme 2.5 Synthesis of N-sulfonyl imines Scheme 2.6 Synthesis of bicyclic guanidine Scheme 2.7 Proposed model of biomimetic decarboxylative Mannich reaction Scheme 2.8 Highly enantioselective...
- 240
- 360
- 0
Bicyclic guanidine catalyzed enantioselective isomerization reactions
... BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ISOMERIZATION REACTIONS LIU HONGJUN 2010 BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ISOMERIZATION REACTIONS LIU HONGJUN ... this study is to develop highly enantioselective isomerization reactions catalyzed by chiral bicyclic guanidines A chiral bicyclic guanidine was found to catalyze the isomerization of alkynes to ... for Brønsted-base Catalyzed Tandem Isomerization- Michael Reactions 74 Chapter Bicyclic Guanidine Catalyzed Asymmetric Tandem Mannich -Isomerization Reactions 4.1 Discovery...
- 197
- 273
- 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 1
... and co-workers Scheme 1. 5 Proposed mechanism of gadolinium -catalyzed desymmetrization of meso- aziridines with TMSCN Scheme 1. 6 Gadolinium -catalyzed desymmetrization of meso- aziridines with TMSCN ... 1. 12 Chiral phosphoric acid -catalyzed desymmetrization of mesoaziridines with TMS-SPh developed by Della Sala and co-workers Scheme 1. 13 Chiral phosphoric acid -catalyzed desymmetrization of mesoaziridines ... desymmetrization of meso N-tosyl aziridines 4a, 4d with benzenethiol 63a Table 2.4 Chiral guanidines catalyzed desymmetrization of meso- aziridines 4a, 1a with bethiol 63a Table 2.5 Desymmetrization of meso...
- 12
- 232
- 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 2
... 79b 79c 79d 25 25 -20 -20 -20 -20 -20 -20 24 24 24 24 20 20 20 20 100 100 90 90 94d 94d 89d 92d 15 13 30 17 33 2 a All reactions were performed with 0. 02 mmol of aziridine, 0.04 mmol of thiol and ... racemization Scheme 2. 12 Chiral bicyclic guanidine catalyzed Diels-Alder reactions of anthrones .21 32 Chapter 2. 1 .2 Bicyclic guanidine catalyzed enantioselective desymmetrization of meso N-tosyl aziridines ... 63d catalyzed by guanidine 79b.a product x mol% temp /° C time /h yield /%b ee /%c 81c -50 48 92 94 82a 2 -50 -20 72 48 89 93 84 90 82b 1 -50 -20 48 60 91 94 89 94 82c 5 -50 -50 -20 72 72 72 67...
- 35
- 261
- 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 3
... Structure of fluoxetine Scheme 3. 4 Synthesis of carbodithioic acid esters of fluoxetine 63 Chapter 3. 2 Guanidine catalyzed enantioselective desymmetrization of meso- aziridines with in situ generated ... Table 3. 3 Chiral guanidine 79b catalyzed desymmetrization of various meso N-acyl aziridines 12 with amine and CS2 a 12 (R =3, 5-dinitrobenzoyl) 96 x mol% time /h yield /%b ee /%c 1d 96b 10 36 98 ... products Scheme 3. 5 Ring opening reaction of meso N-tosyl aziridine 4a with amines and CS2 64 Chapter 3. 2.1 Optimization studies on the enantioselective desymmetrization of meso- aziridines with...
- 16
- 232
- 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 4
... 148 .7, 162.1 FTIR (film): 928, 1 045 , 1216, 142 5, 1520, 1 643 , 2977, 3020, 344 6 cm-1 LRMS (ESI) m/z 44 2.1 (M-H+), HRMS (ESI) m/z 44 2.0 044 (M-H+), calc for C17H14Cl2N3O5S 44 2.0037 The enantiomeric excess ... 28.2, 28 .4, 54. 0, 57.6, 83.5, 84. 7, 128.1, 129 .4, 130.3, 130.9, 133 .4, 137.2, 141 .7, 144 .3, 168.1, 169.1 FTIR (film): 758, 928, 1 045 , 1159, 1216, 1 349 , 142 4, 1522, 1 642 , 1731, 2980, 3020, 343 6 cm-1 ... 84. 0, 94 Chapter 128.9, 130 .4, 1 34. 8, 145 .8, 163.6 FTIR (film): 771, 928, 1 045 , 1216, 1370, 147 7, 1 643 , 1 749 , 2980, 3020, 343 0 cm-1 LRMS (ESI) m/z 41 9.9 (M+Na+), HRMS (ESI) m/z 42 0. 144 8 (M+Na+),...
- 39
- 211
- 0
Guanidine catalyzed enantioselective desymmetrization of meso aziridines 5
... 64.0, 124.3, 1 25. 6, 126.7, 127.7, 128 .5, 129 .5, 130 .5, 132 .5, 134 .5, 1 35. 5, 140.0, 1 65. 4, 189.3, 191.1 FTIR (film): 1020, 1182, 1228, 1271, 1 456 , 152 5, 16 45, 1692, 17 45, 2 856 , 2934, 3 057 cm-1 LRMS ... NMR ( 75 MHz, CDCl3, ppm): δ 14.4, 24.1, 49.4, 64.0, 1 25. 9, 128.7, 133.1, 137.3, 140.1, 153 .4, 1 65. 4, 189.6, 191.0 FTIR (film): 1016, 1 155 82, 1218, 1286, 1380, 1 452 , 151 9, 1 656 , 1681, 1 751 , 2 858 , ... 50 96 37 34 18 10 20 yield /%b 30 20 76 19 35 48 76 38 31 ee /%c 58 60 77 72 75 72 50 43 23 a All reactions were performed with 0. 05 mmol of 102b in 1.0 mL of solvent Overall isolated yield of...
- 25
- 214
- 0
Bicyclic guanidine catalyzed enantioselective allylic addition reactions
... BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ALLYLIC ADDITION REACTIONS WANG JIANMIN 2011 BICYCLIC GUANIDINE CATALYZED ENANTIOSELECTIVE ALLYLIC ADDITION REACTIONS WANG JIANMIN ... develop highly enantioselective allylic addition reactions catalyzed by chiral bicyclic guanidines A chiral bicyclic guanidine was found to catalyze a direct asymmetric allylic addition reaction ... Asymmetric Allylic Addition and Substitution reactions -1 1.1 Overview of Enantioselective Allylic Addition Reactions - 1.2 Stoichiometric Asymmetric Allylic Addition Reactions...
- 260
- 230
- 0
Chiral guanidine catalyzed enantioselective protonation reactions
... Chapter 2 Enantioselective Protonation Reactions Catalyzed by Chiral Bicyclic Guanidine Enantioselective Protonation Reactions Catalyzed by Chiral Bicyclic Guanidine 2.1 Catalytic Enantioselective Protonation Reactions ... List of Abbreviations Chapter 1 Chiral Guanidines Catalyzed Enantioselective Reactions Chiral Guanidines Catalyzed Enantioselective Reactions 1 1.1 Introduction 2 1.2 Chiral Guanidines as Asymmetric Catalysts ... CHIRAL GUANIDINE CATALYZED ENANTIOSELECTIVE PROTONATION REACTIONS LEOW DASHENG JACKSON 2009 CHIRAL GUANIDINE CATALYZED ENANTIOSELECTIVE PROTONATION REACTIONS ...
- 421
- 227
- 0
This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi
... previously in the thesis, the last aims of the questionnaire is to find out the teachers’ judgments on the applicability of the process approach in teaching writing in given context It is interesting ... text is completed PREWRITING COMPOSING/ DRAFTING REVISING EDITING PUBLISHING Figure 2: Model of process approach Since it lays the emphasis on the writers’ writing process, the process approach ... of English teaching at Dong Da high school, focusing on the teachers’ methods and strategies in teaching writing in order to find out the constraints remained in applying the process approach...
- 31
- 560
- 2
THE URBAN AUDIT Towards the Benchmarking of Quality of Life in 58 European Cities docx
... provided from the Urban Audit Web Site to the sites of participating cities Individual City Audits for each of the 58 Urban Audit Cities These Individual City Audits elaborate on the information ... provided the source is acknowledged Foreword This is the first edition of the Urban Yearbook It presents the main results of the pilot phase of the Urban Audit The purpose of the Urban Audit is ... ‘indicators’ As a result of this work, the following refinements were made : - - - - The indicators were regrouped into 21 domains reflecting aspects of urban quality of life The grouping offered...
- 176
- 397
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ... Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase...
- 11
- 571
- 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involved in the biosynthesis of SPA from A actinomycetemcomitans ... for synthesizing the SPAs in other serotypes of A actinomycetemcomitans The biosynthetic pathway for GDP-6-deoxy-D-talose, Ó FEBS 2002 GDP-6-deoxy-D-talose synthetic enzyme (Eur J Biochem 269)...
- 9
- 625
- 0
Báo cáo Y học: Genomic organization of MUC4 mucin gene Towards the characterization of splice variants potx
... with the nucleotide sequence of the MUC4 gene allowed us to establish the nature of the mechanisms responsible for the diversity of transcripts They were generated by the combination of either ... located in the 3¢ region but also for two of them by deletion of the central repetitive domain Until now, because of the lack of knowledge on the genomic organization of the 3¢ region of MUC4, the precise ... cell type may result in modulation of the properties of the molecule On the other hand, the alternative RNA splice forms may only function to reduce the level of expression of the main form sv0MUC4...
- 8
- 341
- 0
facile route to the synthesis of porous - fe2o3 nanorods
... on the synthesis of porous ␣-Fe2 O3 nanorods have been published to date [46] Owing to their specific characteristics and promising applications exploring proper methods for the synthesis of nanoscale ... nanostructures The presence of a rod-like micelle of the surfactant in solution promoted the formation of one-dimensional rod-like structures Herein, we report a new method for the preparation of porous ␣-Fe2 ... shows the HRTEM image of the as-obtained ␣-FeOOH nanorod (D) The HRTEM image recorded from the porous ␣-Fe2 O3 nanorods sample after calcination and the inset in (D) shows the magnified image of...
- 6
- 507
- 0
Từ khóa: how does this reaction demonstrate the law of conservation of mattertowards the sea of lifefostering an integrated and comprehensive approach towards the promotion of healthy diets and physical activityamp 8211 a step towards the fabrication of sam based organic field effect transistorstowards the role of genesmilestones towards the development of an niisynthesis of carboxylic acidsbiosynthesis of the nutritionally nonessential amino acidscatabolism of the carbon skeletons of amino acidsspecial topic amines in condensation reactions the mannich reactionsynthesis of the superheavythe code offers a synthesis of the requirementstowards the automatic identificationa step towards the detectiontowards the orwellian nightmareBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ