Natural convection mass transfer hydromagnetic flow past an oscillating porous plate with heat source in a porous medium
Natural convection mass transfer hydromagnetic flow past an oscillating porous plate with heat source in a porous medium
... flow and heat transfer along a vertical porous plate with variable suction and internal heat generation Das and his associates [16] studied the mass transfer effects on MHD flow and heat transfer ... a porous medium with suction and heat source Natural convection unsteady magnetohydrodynamic mass transfer flow past an infinite vertical porous plate in presence of suction and heat sink was ... Khair K.R Heat and mass transfer by natural convection in a porous medium Int J Heat Mass Transfer 1985; 28, 909-918 [5] Hossain M A. , Begum R .A Effects of mass transfer on the unsteady flow past...
- 8
- 256
- 0
Natural convection unsteady magnetohydrodynamic mass transfer flow past an infinite vertical porous plate in presence of suction and heat sink
... free convection flow past an infinite vertical plate with constant suction and mass transfer Int J Heat Mass Trans.1977, 20, 1363-1373 [5] Hossain M A., Begum R A Effect of mass transfer and free ... convection mass transfer flow of a viscous incompressible electrically conducting fluid past an infinite vertical porous plate in presence of constant suction and heat sink and a transverse magnetic ... constant suction and mass transfer Hossain and Begum [5] estimated the effect of mass transfer and free convection on the flow past a vertical plate Bestman [6] analyzed the natural convection boundary...
- 14
- 493
- 0
Báo cáo khoa học: " Mass transfer, clearance and plasma concentration of procalcitonin during continuous venovenous hemofiltration in patients with septic shock and acute oliguric renal failure" ppsx
... Reinhart K: Plasma concentrations and clearance of procalcitonin during continuous veno-venous hemofiltration in septic patients Shock 2001, 15:171-175 Dahaba A, Elawady G, Rehak P, List W: Procalcitonin ... *** PCT J4 Procalcitonin (PCT) plasma concentration and clearance kinetics during continuous venovenous hemofiltration (CVVH) (a) PCT ultrafiltrate clearances (± standard deviation, ml/min) at 15 ... Procalcitonin and proinflammatory cytokine clearance during continuous venovenous haemofiltration in septic patients Anaesth Intensive Care 2002, 30:269-274 Matson J, Lee P: Evolving concepts of therapy...
- 7
- 217
- 0
Performance analysis of an endoreversible rectangular cycle with heat transfer loss and variable specific heats of working fluid
... rectangular cycle with heat transfer loss and variable specific heats of working fluid Cycle model An air standard rectangular cycle is shown in Figure The heat additions are an isochoric process 1-2 and ... rectangular cycle with heat transfer loss and studied the performance characteristics of the cycle Liu et al [26] modeled irreversible rectangular cycle with friction loss and heat transfer loss by ... loss by considering the effect of variable specific heats of working fluid Rectangular cycle consists of four processes: an isochoric and an isobaric heat addition process, an isochoric and an...
- 8
- 336
- 0
báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx
... to the evolution of the temperature instead of the heat flux at x = The problem (P6) can be considered a non-classical moving boundary problem for the heat equation as a generalization of the ... Argentina 3Depto de Matemática, Universidad Austral, Paraguay 1950, S2000FZF Rosario, Argentina 4Facultad de Ingenier a, Universidad Nacional de Salta, Buenos Aires 144, 4400 Salta, Argentina Salva ... given for Theorem 14.▀ Conclusions In this article, we have proposed and obtained the existence and uniqueness of several initial-boundary value problems for the one-dimensional non-classical heat...
- 17
- 520
- 0
Báo cáo hóa học: " An Approach to Optimum Joint Beamforming Design in a MIMO-OFDM Multiuser System" potx
... is an Assistant Professor at UPC, Barcelona, Spain Currently, he is involved in several national and European research projects Joint Beamforming Design in a MIMO-OFDM Multiuser System Ana I ... converge to any acceptable design The SA algorithm has analogies with the annealing of solids in physics and thermodynamics, as has been explained in [8] The main objective of the annealing process in ... receiver is based on a bank of single-user detectors and a joint design of all the transmit beamvectors is carried out by the centralized manager, attempting to minimize the total transmit power...
- 12
- 292
- 0
Báo cáo y học: "Fibrolipomatous hamartoma in the median nerve in the arm - an unusual location but with MR imaging characteristics: a case report" pps
... clinicopathologic analysis of 26 cases Am J Surg Pathol 1985, 9: 7-1 4 Cavallaro MC, Taylor JA, Gorman JD, Haghighi P, Resnick D: Imaging findings in a patient with fibrolipomatous hamartoma of the median nerve ... hamartoma of the median nerve An incisional biopsy after exploration of the median nerve was done in February 2009 under microscopical dissection The median nerve had a diameter up to cm and there ... and thereafter the median nerve had a normal appearance The diameter of the tumour was 1. 7-2 .5 cm Due to the typical MRI changes (Figure 1) the diagnosis was suggested as a fibrolipomatous hamartoma...
- 6
- 480
- 0
Báo cáo y học: "Spondylarthritis presenting with an allergic immediate systemic reaction to adalimumab in a woman: a case report" pptx
... X-ray and a magnetic resonance imaging scan showed sacroiliitis A diagnosis of spondylarthritis was made The patient was started on therapy with sulfasalazine g/day and deflazacort 7.5 mg/day ... Phadia, Uppsala, Sweden in collaboration with our Laboratory of Immunology and Allergy, was used to assay serumspecific IgE to adalimumab A commercial Phadia ImmunoCAP was used for the assay ... allergic immediate systemic reaction to adalimumab in a woman: a case report Journal of Medical Case Reports 2011 5:155 Submit your next manuscript to BioMed Central and take full advantage of:...
- 4
- 363
- 0
Báo cáo y học: "Intramuscular myxoma associated with an increased carbohydrate antigen 19.9 level in a woman: a case report" pptx
... doi:10.1186/1752-1947-5-184 Cite this article as: Theodorou et al.: Intramuscular myxoma associated with an increased carbohydrate antigen 19.9 level in a woman: a case report Journal of Medical Case Reports 2011 ... neurofibroma, nerve sheath myxoma or neurothekeoma, synovial sarcoma, aggressive angiomyxoma, dermoid and epidermoid cyst, lipoma, neuroma and ganglioma [1,3,4,6,9] CA 19.9, also known as sialylated ... consists of two main macro-molecules: polysaccharide glycosaminoglycans and fibrous structural proteins [9] However, in some cases of IM, areas of increased cellularity and vascularity can be recognized...
- 4
- 385
- 0
Báo cáo y học: "Successful desensitization with human insulin in a patient with an insulin allergy and hypersensitivity to protamine: a case report" pptx
... human insulin (56 U/ml; normal value, ...
- 5
- 378
- 0
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx
... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAACGACGAAGAAGAGGCGGC 643:CCTGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC ... ******************************************************************** p-env3f Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAGGGCAAGAACATTTGAC 272 PmERV Chr 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAGAAAAAGGGCAAGAACATTTGAC 272 *********************************************.********************** ... Contaminant PmERV Chr 69:CCTCATCAGGTCTTCAATGTTACTTGGAGAGTTACCAACTTAATGACAGGACAAACAGCTAATGCTAC 136 69:CCTCATCAGGTCTTCAATGTTACTTGGAGAGTTACCAACTTAATGACAGGACAAACAGCTAATGCTAC 136 ********************************************************************...
- 7
- 349
- 0
Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium
... Bull Malays Math Sci Soc 2006, 29(1), 33-42 [15] Das S S., Satapathy A. , Das J K., Panda J P Mass transfer effects on MHD flow and heat transfer past a vertical porous plate through a porous medium ... 927-941 [9] Sattar M A Free convection and mass transfer flow through a porous medium past an infinite vertical porous plate with time dependant temperature and concentration Ind J Pure Appl Math 1994, ... adjacent to a semi-infinite vertical plate Mech Res Comm 1987, 14, 9-16 [7] Govindarajulu T., Thangaraj C J The effect of variable suction on free convection on a vertical plate in a porous medium...
- 12
- 493
- 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... rib arrangements on heat transfer and flow behavior in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han ... studies of augmented heat transfer and friction in asymmetrically heated rectangular ducts with ribs on the heated wall in transverse, inclined, V-continuous and V- discrete pattern Int Journal of Heat ... Tariq, A. , Keshav Kant and Panigrahi, P K., Heat transfer enhancement using an internally threaded tube”, Proceeding of the 4th ISHMT-ASME and 15th National Conference on Heat and Mass transfer...
- 12
- 831
- 0
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source
... transfer to unsteady magneto-hydrodynamic flow past an infinite vertical moving plate with variable suction Das and his co-workers [16] estimated the mass transfer effects on unsteady flow past ... the variation of the flow parameters such as Prandtl number Pr, magnetic parameter M, permeability parameter Kp and heat source parameter S The variations in the temperature of the flow field are ... Sarangi K C., Jose C B Unsteady free convective MHD flow and mass transfer past a vertical porous plate with variable temperature Bull Cal Math Soc.2005, 97 (2), 137-146 [15] Ogulu A. , Prakash...
- 12
- 428
- 0
Báo cáo hóa học: " Boundary layer flow past a stretching/shrinking surface beneath an external uniform shear flow with a convective surface boundary condition in a nanofluid" pptx
... Magyari and Weidman [41] to a stretching/shrinking surface with a convective boundary condition immersed in a nanofluid, that is, to study the steady boundary layer shear flow over a stretching/shrinking ... stretching/shrinking surface beneath an external uniform shear flow with a convective surface boundary condition in a nanofluid This problem is relevant to several practical applications in the field ... Razak Jengka, Pahang, Malaysia 2Centre for Modelling & Data Analysis, School of Mathematical Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor,...
- 7
- 213
- 0
Từ khóa: an opportunistic relay protocol with dynamic scheduling in wireless body area network8 5 patterns relationships and algebraic thinking the student uses graphs tables and algebraic representations to make predictions and solve problems the student is expected to b use an algebraic expression to find any term in a sequencestrong convection effects in heat and mass transfer at low reynolds number an introduction5forced convection heat and mass transfer from a cylinder2theoretical models mass transfer in film flow§3 4 mass transfer in laminar flow§ 3 5 mass transfer in turbulent flowheat amp mass transfer in duct flowgas liquid flow patterns and mass transferheat and mass transferquestion paper of heat and mass transferquestion bank heat and mass transferme2251 heat and mass transfer question bankheat and mass transfer anna university question bankheat and mass transfer anna university question bank pdfNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ