0
  1. Trang chủ >
  2. Cao đẳng - Đại học >
  3. Y - Dược >

EXPLORING THE ROLE OF PHARMACOKINETIC ALTERATIONS IN TYROSINE KINASE INHIBITORS (TKIS) ASSOCIATED TOXICITIES

EXPLORING THE ROLE OF PHARMACOKINETIC ALTERATIONS IN TYROSINE KINASE INHIBITORS (TKIS) ASSOCIATED TOXICITIES

EXPLORING THE ROLE OF PHARMACOKINETIC ALTERATIONS IN TYROSINE KINASE INHIBITORS (TKIS) ASSOCIATED TOXICITIES

... of tyrosine kinase inhibitors 110 5.3.2 Potential effect of enzyme inducer/inhibitor on pharmacokinetics of tyrosine kinase inhibitors 113 5.3.3 Effect of tyrosine kinase inhibitors ... Overcoming tyrosine kinase inhibitors- induced hepatotoxicity 160 6.5.1 Switching tyrosine kinase inhibitors 161 6.5.2 Alternative dosing 161 6.5.3 Reversibility of toxicities ... _ Summary The advent of molecular targeted therapy in the late 1990s marks a major breakthrough in the fight against cancer The critical role of tyrosine kinases in the control of cancer phenotypes,...
  • 254
  • 1,025
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
  • 6
  • 488
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf

... setting There are data supporting the use of CT perfusion in acute stroke management [11] Relative MTT and absolute CBV are CT perfusion parameters that help define areas of infarct from areas of ... hyperperfusion state during the ictal state has also been shown with SPECT and f-MRI in patients with focal epilepsy [16,17] CT perfusion has the advantages of routine availability, short acquisition ... mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations International Journal of Emergency Medicine 2012 5:4 Submit your manuscript to a journal and benefit...
  • 4
  • 447
  • 0
báo cáo khoa học:

báo cáo khoa học: " Exploring the role of organizational policies and procedures in promoting research utilization in registered nurses" potx

... factors influencing the use of RBPs among staff nurses in the Canadian province of Newfoundland and Labrador with the specific aim of understanding the role of P&Ps in promoting research utilization ... understanding of the factors that influence nurses' use of RBPs, and the role that P&Ps may play in promoting research utilization in nurses Our findings suggest nurses use P&Ps to guide their ... Use of nursing practice research findings Nursing Research 1987, 36:344-349 Michel Y, Sneed NV: Dissemination and use of research h findings in nursing practice Journal of Professional Nursing...
  • 11
  • 417
  • 0
The role of leadership theory in raising the profile of women in management

The role of leadership theory in raising the profile of women in management

... in raising the profile of women in management or leadership roles Early leadership theories In the 18th and 19th centuries, philosophers suggested a theory of leadership which was termed the ... although the leadership literature has played a significant role in raising the profile of women in management, further advances are required in order to advance the careers of women in management ... behavioural theories can be viewed as limited in raising the profile of women in management However, during this period of research, there was an emerging recognition of the importance of a concern...
  • 16
  • 962
  • 1
Globalization: the Role of Institution Building in the Financial Sector _ The Case Study of China

Globalization: the Role of Institution Building in the Financial Sector _ The Case Study of China

... globalization II Review of Institution Building in the Financial Sector A Main driving forces of institution building A review of the developments of China s financial sector over the past 20 years reveals ... unique role in institution building in the financial sector They help to mitigate financial repression in China, to establish sound financial system, to enlarge contribution of the financial sector ... Globalization: the Role of Institution Building in the Financial Sector -The Case Study of China August, 2003 I Introduction Financial globalization could be described as a process in which...
  • 26
  • 975
  • 1
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG vaccine for the control of TB (2 ) Based on available information concerning the effectiveness ... vaccination in the prevention and control of TB in the United States CDC, the Advisory Council for the Elimination of Tuberculosis (ACET), and the Advisory Committee on Immunization Practices (ACIP),...
  • 27
  • 1,309
  • 3
Tài liệu The Role of Community Banks in the U.S. Economy pdf

Tài liệu The Role of Community Banks in the U.S. Economy pdf

... Reserve therefore has a strong interest in understanding issues facing community banks I THE CURRENT ROLE OF COMMUNITY BANKS The banking system in the United States has always been unique in the ... While community banks still comprise the vast majority of banks, the question arises whether their role in the banking system has declined to the point of insignificance This section shows that community ... were not there, other financial services providers might readily step in to take their place This article examines the role of community banks in the U.S economy The first section of the article...
  • 29
  • 601
  • 1
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

... geometry of the hinge loop after ligation Also in this case no clashes were detected at Electrostatic interactions and antitumor RNases the dimer interface of the models or in the surroundings of the ... the C-terminal and N-terminal structural regions, respectively, of the two A and B monomers of the dimeric RNase The black circle between the monomers indicates the mass center of the dimer Electrostatic ... Electrostatic interactions and antitumor RNases r ¼ 180° and i ¼ 90° In this orientation, characterized by the strongest electrostatic attraction of the RNases with the membrane, all RNases pointed their...
  • 11
  • 643
  • 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

... side-chains are important for the GABA transport activity 1- Deoxymannojirimycin inhibits the GABA- uptake of GAT1 In order to gain further insight into the role of the terminal structures of the N-glycans ... N-glycans, in particular their terminal structures, are involved in regulating the GABA translocation of GAT1, but not in binding of GAT1 to GABA Transport of GABA by GAT1 across the cell membrane ... trimming of their N-oligosaccharides strongly affected their GABAuptake activity These indicate that the terminal structure of the oligosaccharides facilitate efficient GABA- uptake activity of the...
  • 14
  • 654
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx

... processing approach to comprehension of French, w i l l form the basis of the discussion I t is the in interaction of the results of these asynchronous processes that the process of comprehension ... at any moment of the process are context dependent; they depend on the "current state" of the system The system presents an i n i t i a l attempt to integrate AI and brain theory, BT, on two levels, ... recognition comprehension and automatic translation into French One issue, how to chunk French into a phonetic representation of words, along with the implications of the determined representation...
  • 5
  • 609
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx

... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war- 145 den" in German, and the use of present ... (auxiliary "haben') In this corpus, texts from the domains of law and economy contain more VAINF than others The potential meaning of common punctuation marks is quite clear: the longer the sentences...
  • 8
  • 689
  • 1
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

... good enterprises, they appear unable to ration bad ones Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey ENTERPRISE ADJUSTMENT AND THE ROLE ... Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey In 1996, the credit has overall been decreasing for 53% of the sample, it has been increasing ... passive, and will appear as endogenous variable in section 10 Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey resources as an important...
  • 30
  • 635
  • 0
BEYOND MICROCREDIT: THE ROLE OF SAVINGS BANKS IN MICROFINANCE potx

BEYOND MICROCREDIT: THE ROLE OF SAVINGS BANKS IN MICROFINANCE potx

... CHARACTERISTICS OF MICROFINANCE This edition of Perspectives analyses the role of savings banks and WSBI members in microfinance. 1 The first section discusses microfinance in general The second section ... Report Microfinance Services by Savings Banks in Africa – The Sleeping Giants have started moving, but where are they going? 2.1 Summary 2.2 Main characteristics of microfinance in Africa 2.3 Savings ... many of them have been pioneers in the Latin American microfinance industry As of today, out of 15 Latin American members are active in microfinance These members are involved in different ways in...
  • 124
  • 576
  • 0

Xem thêm

Từ khóa: the role of positive feedback in homeostasisdescribe the role of data networking in communicationsthe role of critical thinking in educationthe role of critical thinking in problem solvingthe role of critical thinking in persuasionthe role of critical thinking in decision makingthe role of critical thinking in businessthe role of critical thinking in islamthe role of critical thinking in crosscultural psychologythe role of critical thinking in criminal justice administrationthe role of critical thinking in effective decision makingthe role of energy storage in the pv industrythe role of energy storage in development of smart gridsthe role of effective communication in conflict resolution in an organisationthe role of effective communication in conflict resolutionNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ