Constructive role of internal noise for the detection of weak signal in cell system
Constructive role of internal noise for the detection of weak signal in cell system
... resonance among the noise, the noise- induced oscillation, and the signal can intensively enhance the ability of the system in detection of the weak signal, especially when the frequency of the signal ... cross-coupling (ICC) cell model, we investigated how the internal noise would influence the detection of weak signal Model The model used in the present article describes the dynamics of calcium ions in ... that, near the Hopf bifurcation point, instead of trying to resist the internal molecular noise, living cell systems may have learned to exploit the internal noise to intensively enhance the ability...
- 4
- 285
- 0
The role of p38 MAPK in cell cycle checkpoint control following DNA damage
... examined the role of Chk1, a canonical member of the ATM/ATR pathway, in DNA damage- induced G2 checkpoint control While examining the role of p38 in the G2 checkpoint pathway, we found that inhibition ... many of the key regulators of the cell cycle, including Cdc2/cyclinB complex, now known CDK1 (100) The main goal of cells in the G1 phase of the cell cycle is to prepare for DNA synthesis in the ... (186,200) The isoforms of p38 MAPK are p38 , p38 , p38 and p38 The best-characterized isoforms of p38 are the and isoforms (98) The p38 and p38 proteins are ubiquitously expressed in all cell types,...
- 291
- 216
- 0
Elucidation of the physiologic role of TRIP br2 in cell cycle regulation and cancer pathogenesis
... 2000) CDK protein levels remain stable during the cell cycle, in sharp contrast to their activating proteins, the cyclins The oscillatory expression of most cyclin proteins during cell cycle progression ... C-terminus of TRIP- Br2, which includes the putative C-terminal NES of TRIP- Br2, stabilized TRIP- Br2 in G2/M phase 189 Figure 30E Inhibition of nuclear export of TRIP- Br2 by LMB restores its stability in ... include the cyclin-dependent kinases (CDKs), a family of serine/threonine protein kinases that are activated at specific points of the cell cycle To date, nine CDKs have been identified and, of these,...
- 245
- 231
- 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx
... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher ... LOD of the duplex real-time RT-PCR assay was 38.99 IU/ml and the specificity was 100% Furthermore, the cost of the duplex real-time RT-PCR assay was considerably lower than that of the CAP/CTM assay, ... the duplex primer/probe assay could be comparable with or even exceed that of the CAP/CTM assay In this study, armored RNA was successfully used as IC in the duplex real-time RT-PCR assay The IC...
- 9
- 322
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc of any type ROC AUC Odds Ratio ... in this meta -analysis was not to study MCG as a screening device, but instead to focus primarily on its potential as a diagnostic assay for relevant coronary stenosis Resting ECG analysis, including...
- 13
- 684
- 0
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens
... Identification of C8-modified deoxyinosine and N2- and C8-modified deoxyguanosine as major products of the in vivo reaction of N-hydroxy-6-aminochrysene with DNA and the formation of the adducts in isolated ... recommend the Ames test using these sensitive strains (especially YG1041 and/ or YG1042) in combination with the standard tester strains (TA98 and TA100 series), in order to detect the mutagenicity of ... aid the identification of mutagenic alkylating chemicals such as Nmethyl-N’-nitro-N-nitrosoguanidine (MNNG) Of the 255 chemicals tested, chemicals (3.1%) were mutagenic in YG3003 and 12 chemicals...
- 6
- 735
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG vaccine for the control of TB (2 ) Based on available information concerning the effectiveness ... vaccination in the prevention and control of TB in the United States CDC, the Advisory Council for the Elimination of Tuberculosis (ACET), and the Advisory Committee on Immunization Practices (ACIP),...
- 27
- 1,309
- 3
Critical evaluation of diagnostic aids for the detection of oral cancer docx
... al., Critical evaluation of diagnostic aids for the , Oral Oncol (2007), doi:10.1016/j.oraloncology.2007.06.011 ARTICLE IN PRESS Critical evaluation of diagnostic aids for the detection of oral cancer ... al., Critical evaluation of diagnostic aids for the , Oral Oncol (2007), doi:10.1016/j.oraloncology.2007.06.011 ARTICLE IN PRESS Critical evaluation of diagnostic aids for the detection of oral cancer ... al., Critical evaluation of diagnostic aids for the , Oral Oncol (2007), doi:10.1016/j.oraloncology.2007.06.011 ARTICLE IN PRESS Critical evaluation of diagnostic aids for the detection of oral cancer...
- 13
- 1,099
- 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx
... v INTERNATIONAL STANDARD ISO 6579:2002(E) Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp WARNING — In order to safeguard the health of ... Members of ISO and IEC maintain registers of currently valid International Standards ISO 6887-1, Microbiology of food and animal feeding stuffs — Preparation of test samples, initial suspension and ... is taken in the disposal of all incubated materials Scope This International Standard specifies a horizontal method for the detection of Salmonella, including Salmonella Typhi and Salmonella Paratyphi...
- 34
- 690
- 0
ag doped wo3-based powder sensor for the detection of no gas in air
... measured in a ¯owing stream of pure air or in 40 ppm NO in air (60:40 mixture from an air cylinder with another cylinder (BOC special gases) containing ca 100 ppm NO balanced with air) by the ac ... concentration of NO and NO2 gases because of the low concentration, one of the roles of the Ag is apparent to provide surface for the conversion of NO to NO2 according to the literature [18] It is worth noting ... However, there is limited work reported in the literature on addressing the precise sensing mechanism for the NOx gases detection over WO3-based sensors and there is no work to reveal the roles of the...
- 8
- 502
- 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3'...
- 12
- 509
- 0
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot
... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription,...
- 12
- 471
- 0
Báo cáo hóa học: "Biocompatible micro-sized cell culture chamber for the detection of nanoparticle-induced IL8 promoter activity on a small cell population" pot
... guarantee a statistical analysis of the generated data The MCC represents an array of miniaturized cell culture chambers for permanent noninvasive characterization of individual cells in a cell ... microplates, the new miniaturized cell culture chamber enables a fast and sensitive quantification of IL8 promoter activations that is based on the analysis of individual cells within a population ... for the continuous observation of GFP expression and the quantification of concentration- and time-dependent nanoparticle-induced IL8 promoter activation in adherent cells of a small cell population...
- 14
- 632
- 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx
... that a TNAR is available in this latter case A Unknown parameters (µs, φs) and known total noise (R, C) Under the assumptions A1 and A2 , assuming known parameters R, C and s and unknown parameters ... performance In a same way, the O9 detector, which assumes that all the parameters of the sources are unknown, has the lowest performance Moreover, for a given set of unknown desired signal parameters, ... GLRT-BASED ARRAY RECEIVERS FOR THE DETECTION OF A KNOWN SIGNAL WITH UNKNOWN PARAMETERS CORRUPTED BY NONCIRCULAR INTERFERENCES Pascal Chevalier(1)(2)*, Abdelkader Oukaci(3), Jean-Pierre Delmas(3)...
- 45
- 467
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanoparticle-based hybridization ... separation and diagnosis, the superparamagnetic nanoparticle has a unique advantage over others Herein, we report a novel detection method of HPV DNA combining the advantages of QDs and manipulability...
- 9
- 469
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam